Incidental Mutation 'R4126:Cdk5rap1'
ID315391
Institutional Source Beutler Lab
Gene Symbol Cdk5rap1
Ensembl Gene ENSMUSG00000027487
Gene NameCDK5 regulatory subunit associated protein 1
Synonyms
MMRRC Submission 041634-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.561) question?
Stock #R4126 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154335380-154373010 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154368895 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 108 (C108R)
Ref Sequence ENSEMBL: ENSMUSP00000105353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028990] [ENSMUST00000109730] [ENSMUST00000109731]
Predicted Effect probably damaging
Transcript: ENSMUST00000028990
AA Change: C108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028990
Gene: ENSMUSG00000027487
AA Change: C108R

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 3.2e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109730
AA Change: C108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105352
Gene: ENSMUSG00000027487
AA Change: C108R

DomainStartEndE-ValueType
Pfam:UPF0004 100 181 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109731
AA Change: C108R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105353
Gene: ENSMUSG00000027487
AA Change: C108R

DomainStartEndE-ValueType
Pfam:UPF0004 100 203 1.1e-31 PFAM
Elp3 247 486 4.83e-52 SMART
Pfam:TRAM 500 574 1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150308
Meta Mutation Damage Score 0.6 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 89% (33/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cyclin-dependent kinase 5 activity. This protein has also been reported to modify RNA by adding a methylthio-group and may thus have a dual function as an RNA methylthiotransferase and as an inhibitor of cyclin-dependent kinase 5 activity. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele show deficient mitochondrial tRNA modification, reduced mitochondrial protein synthesis, defects in oxidative phosphorylation, high susceptibility to stress-induced mitochondrial remodeling, and accelerated myopathy and cardiac dysfunction under stressed conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,531,669 W249R probably benign Het
Ank G A 15: 27,590,373 V348I probably benign Het
Atad3a A T 4: 155,754,061 probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Celsr2 G T 3: 108,402,097 A1614D possibly damaging Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
E2f8 T C 7: 48,875,607 I206V probably damaging Het
Glyat G T 19: 12,651,479 V213F probably benign Het
Gpatch1 C T 7: 35,293,654 probably null Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnc1 T C 7: 46,398,002 Y109H probably damaging Het
Kif12 C T 4: 63,166,437 S548N probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Naalad2 T C 9: 18,347,470 Y503C probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr1061 A T 2: 86,413,224 I276N probably damaging Het
Parp8 C A 13: 116,868,469 K685N possibly damaging Het
Prr14l G T 5: 32,828,003 H1383N probably damaging Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Slc6a20a G T 9: 123,660,533 F148L probably damaging Het
Spag11b T C 8: 19,141,379 S23P possibly damaging Het
Stac C A 9: 111,604,058 probably null Het
Taf11 T C 17: 27,901,772 K175E possibly damaging Het
Tll1 T C 8: 64,118,014 R175G possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Usp4 T C 9: 108,360,117 V128A probably benign Het
Zfp788 T C 7: 41,649,436 F479L probably damaging Het
Zmiz1 T G 14: 25,656,930 S877A possibly damaging Het
Other mutations in Cdk5rap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Cdk5rap1 APN 2 154366036 missense probably damaging 1.00
IGL02162:Cdk5rap1 APN 2 154335569 missense probably damaging 0.98
IGL02626:Cdk5rap1 APN 2 154365960 critical splice donor site probably null
IGL03278:Cdk5rap1 APN 2 154370702 missense probably benign 0.00
R1052:Cdk5rap1 UTSW 2 154360599 missense possibly damaging 0.96
R1333:Cdk5rap1 UTSW 2 154360654 missense probably damaging 0.97
R1552:Cdk5rap1 UTSW 2 154370695 missense probably benign 0.00
R1553:Cdk5rap1 UTSW 2 154352251 missense probably damaging 1.00
R2107:Cdk5rap1 UTSW 2 154353246 missense probably benign 0.22
R3946:Cdk5rap1 UTSW 2 154348716 missense probably damaging 1.00
R4715:Cdk5rap1 UTSW 2 154361835 makesense probably null
R4865:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4866:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4867:Cdk5rap1 UTSW 2 154370956 critical splice acceptor site probably null
R4946:Cdk5rap1 UTSW 2 154368874 missense possibly damaging 0.91
R5087:Cdk5rap1 UTSW 2 154342395 missense probably damaging 1.00
R5319:Cdk5rap1 UTSW 2 154335569 missense possibly damaging 0.62
R5383:Cdk5rap1 UTSW 2 154350835 missense possibly damaging 0.78
R5582:Cdk5rap1 UTSW 2 154345974 missense probably benign 0.01
R5780:Cdk5rap1 UTSW 2 154345868 frame shift probably null
R6262:Cdk5rap1 UTSW 2 154370686 missense probably benign 0.04
R6274:Cdk5rap1 UTSW 2 154368241 missense probably damaging 0.99
R7263:Cdk5rap1 UTSW 2 154360732 missense probably benign 0.12
R7388:Cdk5rap1 UTSW 2 154360675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAACCTCTTCCTGAGATTC -3'
(R):5'- GCACATAATAGGCGTGTGTATGTG -3'

Sequencing Primer
(F):5'- GAGATTCACTGCATCTAAGAACCTG -3'
(R):5'- CTGAAAGGCTGTTACTAATTTCTGGC -3'
Posted On2015-05-14