Incidental Mutation 'R4126:Glyat'
ID315419
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
MMRRC Submission 041634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4126 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12651479 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 213 (V213F)
Ref Sequence ENSEMBL: ENSMUSP00000114002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect probably benign
Transcript: ENSMUST00000044976
AA Change: V247F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: V247F

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119960
AA Change: V213F

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683
AA Change: V213F

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157069
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 89% (33/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T A 8: 60,531,669 W249R probably benign Het
Ank G A 15: 27,590,373 V348I probably benign Het
Atad3a A T 4: 155,754,061 probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cdk5rap1 A G 2: 154,368,895 C108R probably damaging Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Celsr2 G T 3: 108,402,097 A1614D possibly damaging Het
Chd9 A G 8: 91,051,284 D2641G probably damaging Het
E2f8 T C 7: 48,875,607 I206V probably damaging Het
Gpatch1 C T 7: 35,293,654 probably null Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnc1 T C 7: 46,398,002 Y109H probably damaging Het
Kif12 C T 4: 63,166,437 S548N probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myrip C A 9: 120,464,698 S753* probably null Het
Naalad2 T C 9: 18,347,470 Y503C probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr1061 A T 2: 86,413,224 I276N probably damaging Het
Parp8 C A 13: 116,868,469 K685N possibly damaging Het
Prr14l G T 5: 32,828,003 H1383N probably damaging Het
Pxn A G 5: 115,546,907 R264G probably damaging Het
Slc6a20a G T 9: 123,660,533 F148L probably damaging Het
Spag11b T C 8: 19,141,379 S23P possibly damaging Het
Stac C A 9: 111,604,058 probably null Het
Taf11 T C 17: 27,901,772 K175E possibly damaging Het
Tll1 T C 8: 64,118,014 R175G possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Usp4 T C 9: 108,360,117 V128A probably benign Het
Zfp788 T C 7: 41,649,436 F479L probably damaging Het
Zmiz1 T G 14: 25,656,930 S877A possibly damaging Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2416:Glyat UTSW 19 12651254 missense possibly damaging 0.50
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R2960:Glyat UTSW 19 12639850 missense probably damaging 1.00
R3958:Glyat UTSW 19 12639833 missense probably benign 0.05
R4561:Glyat UTSW 19 12651280 missense possibly damaging 0.88
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
R7044:Glyat UTSW 19 12650265 missense probably benign 0.05
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTGTCCATGCTGCCTTG -3'
(R):5'- TCAACACCAGCTTCTGTTTGAGTC -3'

Sequencing Primer
(F):5'- CCATGCTGCCTTGGTGAATAAATTC -3'
(R):5'- TGAGTCCAGCTTCACATAGGCATG -3'
Posted On2015-05-14