Mutagenetix > Incidental Mutation

Incidental Mutation 'R4127:Sorcs1'

315459

Institutional Source

Beutler Lab

Gene Symbol

Sorcs1

Ensembl Gene

ENSMUSG00000043531

Gene Name

sortilin-related VPS10 domain containing receptor 1

Synonyms

MMRRC Submission

040860-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R4127 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

50131737-50667084 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 50210597 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 756 (D756G)

Ref Sequence

ENSEMBL: ENSMUSP00000148254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000072685
AA Change: D756G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: D756G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111756
AA Change: D756G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: D756G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164039
AA Change: D756G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: D756G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	94	113	N/A	INTRINSIC
VPS10	196	797	N/A	SMART
PKD	799	889	3.84e-1	SMART
PKD	897	975	8.63e-1	SMART
transmembrane domain	1098	1120	N/A	INTRINSIC
low complexity region	1129	1142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168357

SMART Domains

Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

Domain	Start	End	E-Value	Type
VPS10	1	320	6.99e-58	SMART
PKD	322	412	3.84e-1	SMART
PKD	420	498	8.63e-1	SMART
transmembrane domain	621	643	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209413
AA Change: D756G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000209783
AA Change: D756G

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000211008
AA Change: D756G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000211687
AA Change: D756G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,141,973 (GRCm39)	H3R	probably benign	Het
Actg2	A	T	6: 83,499,866 (GRCm39)	F128Y	possibly damaging	Het
Ankrd6	G	A	4: 32,822,241 (GRCm39)	T176M	probably damaging	Het
Atp6ap1l	T	C	13: 91,046,826 (GRCm39)	D117G	probably damaging	Het
Cd209b	A	G	8: 3,968,714 (GRCm39)	I284T	probably damaging	Het
Cfl2	C	T	12: 54,908,143 (GRCm39)	A123T	probably benign	Het
Cgnl1	T	C	9: 71,631,822 (GRCm39)	T510A	probably benign	Het
Chn2	G	T	6: 54,249,963 (GRCm39)	R24M	probably damaging	Het
Cyfip2	T	C	11: 46,161,474 (GRCm39)	I339V	probably benign	Het
Etl4	C	T	2: 20,748,886 (GRCm39)	P539L	possibly damaging	Het
Fras1	A	G	5: 96,918,512 (GRCm39)	D3516G	probably benign	Het
Frem2	T	C	3: 53,433,317 (GRCm39)	Y2669C	probably damaging	Het
Gga2	G	T	7: 121,601,943 (GRCm39)	H205N	probably damaging	Het
Gm5592	G	A	7: 40,938,491 (GRCm39)	G591D	probably benign	Het
Gtf3c1	A	T	7: 125,246,622 (GRCm39)	C1562*	probably null	Het
Heatr3	T	A	8: 88,864,939 (GRCm39)	C59S	probably damaging	Het
Heatr5b	A	G	17: 79,060,603 (GRCm39)	M2024T	possibly damaging	Het
Jarid2	T	C	13: 45,055,732 (GRCm39)	S313P	probably damaging	Het
Lzts3	A	G	2: 130,477,285 (GRCm39)	S502P	probably damaging	Het
Or5d36	A	G	2: 87,901,579 (GRCm39)	V49A	probably benign	Het
Pcdhb2	A	T	18: 37,428,594 (GRCm39)	D189V	probably damaging	Het
Pias3	G	T	3: 96,606,982 (GRCm39)	G82C	probably damaging	Het
Polg	T	C	7: 79,105,285 (GRCm39)	E753G	probably damaging	Het
Pus10	T	C	11: 23,668,654 (GRCm39)		probably null	Het
Pxn	A	G	5: 115,684,966 (GRCm39)	R264G	probably damaging	Het
Rag1	A	G	2: 101,472,416 (GRCm39)	Y909H	probably damaging	Het
Rell2	A	G	18: 38,091,267 (GRCm39)	H144R	probably benign	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Ryr2	C	T	13: 11,602,323 (GRCm39)	V4520I	possibly damaging	Het
Scp2	A	G	4: 107,921,181 (GRCm39)	F10L	probably benign	Het
Slc9b2	T	C	3: 135,035,598 (GRCm39)	Y356H	probably benign	Het
Stra6	T	A	9: 58,058,501 (GRCm39)	V454E	probably damaging	Het
Tbc1d8	T	C	1: 39,411,512 (GRCm39)	N1108S	probably benign	Het
Tep1	C	T	14: 51,081,191 (GRCm39)	R1349Q	possibly damaging	Het
Tmem132d	T	C	5: 128,345,884 (GRCm39)	R213G	probably benign	Het
Ubash3a	T	C	17: 31,456,249 (GRCm39)	Y506H	probably damaging	Het
Xcr1	A	C	9: 123,685,561 (GRCm39)	V67G	probably damaging	Het
Zranb2	C	A	3: 157,243,227 (GRCm39)	C74*	probably null	Het

Other mutations in Sorcs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Sorcs1	APN	19	50,178,492 (GRCm39)	missense	probably damaging	1.00
IGL00983:Sorcs1	APN	19	50,164,566 (GRCm39)	missense	probably damaging	0.98
IGL01125:Sorcs1	APN	19	50,216,639 (GRCm39)	missense	probably damaging	1.00
IGL01320:Sorcs1	APN	19	50,276,517 (GRCm39)	splice site	probably benign
IGL01445:Sorcs1	APN	19	50,141,504 (GRCm39)	missense	probably damaging	1.00
IGL01682:Sorcs1	APN	19	50,169,944 (GRCm39)	missense	probably benign	0.43
IGL01799:Sorcs1	APN	19	50,218,647 (GRCm39)	critical splice donor site	probably null
IGL02044:Sorcs1	APN	19	50,276,597 (GRCm39)	splice site	probably benign
IGL02111:Sorcs1	APN	19	50,218,683 (GRCm39)	missense	probably benign	0.00
IGL02364:Sorcs1	APN	19	50,322,036 (GRCm39)	missense	probably damaging	1.00
IGL02378:Sorcs1	APN	19	50,171,109 (GRCm39)	nonsense	probably null
IGL02498:Sorcs1	APN	19	50,666,606 (GRCm39)	missense	probably benign
IGL02658:Sorcs1	APN	19	50,178,530 (GRCm39)	missense	probably damaging	1.00
IGL02939:Sorcs1	APN	19	50,666,368 (GRCm39)	nonsense	probably null
IGL02942:Sorcs1	APN	19	50,463,875 (GRCm39)	missense	probably damaging	1.00
IGL03057:Sorcs1	APN	19	50,248,194 (GRCm39)	nonsense	probably null
IGL03230:Sorcs1	APN	19	50,230,531 (GRCm39)	missense	probably damaging	1.00
P0033:Sorcs1	UTSW	19	50,141,345 (GRCm39)	missense	probably damaging	0.98
R0109:Sorcs1	UTSW	19	50,367,329 (GRCm39)	splice site	probably benign
R0115:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0242:Sorcs1	UTSW	19	50,216,659 (GRCm39)	missense	probably damaging	1.00
R0325:Sorcs1	UTSW	19	50,301,480 (GRCm39)	splice site	probably null
R0481:Sorcs1	UTSW	19	50,624,891 (GRCm39)	intron	probably benign
R0581:Sorcs1	UTSW	19	50,241,139 (GRCm39)	missense	possibly damaging	0.70
R0669:Sorcs1	UTSW	19	50,230,380 (GRCm39)	splice site	probably benign
R0980:Sorcs1	UTSW	19	50,220,761 (GRCm39)	missense	probably benign	0.04
R1158:Sorcs1	UTSW	19	50,132,598 (GRCm39)	unclassified	probably benign
R1519:Sorcs1	UTSW	19	50,241,025 (GRCm39)	missense	probably benign	0.05
R1669:Sorcs1	UTSW	19	50,463,860 (GRCm39)	missense	probably damaging	0.99
R1779:Sorcs1	UTSW	19	50,163,481 (GRCm39)	splice site	probably benign
R1783:Sorcs1	UTSW	19	50,216,747 (GRCm39)	critical splice acceptor site	probably null
R1927:Sorcs1	UTSW	19	50,210,633 (GRCm39)	missense	probably damaging	1.00
R1935:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R1936:Sorcs1	UTSW	19	50,221,082 (GRCm39)	missense	probably damaging	0.96
R2109:Sorcs1	UTSW	19	50,666,630 (GRCm39)	missense	probably benign
R2206:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R2207:Sorcs1	UTSW	19	50,218,655 (GRCm39)	missense	possibly damaging	0.81
R3031:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3032:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3107:Sorcs1	UTSW	19	50,199,088 (GRCm39)	missense	possibly damaging	0.83
R3508:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R3738:Sorcs1	UTSW	19	50,139,659 (GRCm39)	missense	probably benign	0.03
R4212:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4213:Sorcs1	UTSW	19	50,213,613 (GRCm39)	missense	probably damaging	0.98
R4385:Sorcs1	UTSW	19	50,178,599 (GRCm39)	missense	probably benign	0.01
R4424:Sorcs1	UTSW	19	50,367,379 (GRCm39)	missense	probably damaging	0.97
R4603:Sorcs1	UTSW	19	50,301,402 (GRCm39)	critical splice donor site	probably null
R4679:Sorcs1	UTSW	19	50,171,107 (GRCm39)	missense	probably benign
R4780:Sorcs1	UTSW	19	50,132,419 (GRCm39)	unclassified	probably benign
R4781:Sorcs1	UTSW	19	50,171,119 (GRCm39)	missense	probably damaging	1.00
R4823:Sorcs1	UTSW	19	50,218,740 (GRCm39)	missense	possibly damaging	0.87
R4823:Sorcs1	UTSW	19	50,666,578 (GRCm39)	missense	possibly damaging	0.92
R4883:Sorcs1	UTSW	19	50,220,741 (GRCm39)	missense	probably benign	0.00
R5091:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
R5105:Sorcs1	UTSW	19	50,213,579 (GRCm39)	missense	possibly damaging	0.57
R5437:Sorcs1	UTSW	19	50,241,040 (GRCm39)	missense	probably benign	0.19
R5574:Sorcs1	UTSW	19	50,210,571 (GRCm39)	missense	probably damaging	1.00
R5734:Sorcs1	UTSW	19	50,171,213 (GRCm39)	missense	probably benign	0.04
R6045:Sorcs1	UTSW	19	50,178,555 (GRCm39)	nonsense	probably null
R6091:Sorcs1	UTSW	19	50,276,539 (GRCm39)	missense	possibly damaging	0.64
R6119:Sorcs1	UTSW	19	50,276,532 (GRCm39)	missense	probably damaging	0.98
R6226:Sorcs1	UTSW	19	50,169,852 (GRCm39)	missense	probably damaging	1.00
R6337:Sorcs1	UTSW	19	50,132,562 (GRCm39)	missense	probably benign	0.00
R6378:Sorcs1	UTSW	19	50,213,615 (GRCm39)	missense	possibly damaging	0.57
R6782:Sorcs1	UTSW	19	50,164,560 (GRCm39)	nonsense	probably null
R6792:Sorcs1	UTSW	19	50,666,606 (GRCm39)	missense	probably benign
R6891:Sorcs1	UTSW	19	50,213,557 (GRCm39)	nonsense	probably null
R7151:Sorcs1	UTSW	19	50,301,420 (GRCm39)	missense	probably damaging	1.00
R7223:Sorcs1	UTSW	19	50,178,480 (GRCm39)	missense	probably benign	0.06
R7356:Sorcs1	UTSW	19	50,163,595 (GRCm39)	missense	possibly damaging	0.86
R7471:Sorcs1	UTSW	19	50,250,701 (GRCm39)	missense	probably damaging	1.00
R7474:Sorcs1	UTSW	19	50,141,550 (GRCm39)	missense	possibly damaging	0.65
R7503:Sorcs1	UTSW	19	50,141,490 (GRCm39)	missense	probably benign
R7506:Sorcs1	UTSW	19	50,171,112 (GRCm39)	nonsense	probably null
R7573:Sorcs1	UTSW	19	50,141,234 (GRCm39)	nonsense	probably null
R7867:Sorcs1	UTSW	19	50,218,698 (GRCm39)	nonsense	probably null
R7911:Sorcs1	UTSW	19	50,132,470 (GRCm39)	missense	unknown
R8032:Sorcs1	UTSW	19	50,463,846 (GRCm39)	missense	probably benign	0.28
R8063:Sorcs1	UTSW	19	50,132,415 (GRCm39)	missense	unknown
R8463:Sorcs1	UTSW	19	50,248,248 (GRCm39)	missense	probably damaging	1.00
R8682:Sorcs1	UTSW	19	50,367,398 (GRCm39)	missense	probably damaging	0.99
R8724:Sorcs1	UTSW	19	50,139,658 (GRCm39)	missense	probably benign	0.33
R8926:Sorcs1	UTSW	19	50,241,096 (GRCm39)	missense	possibly damaging	0.94
R9160:Sorcs1	UTSW	19	50,213,658 (GRCm39)	missense	probably damaging	1.00
R9173:Sorcs1	UTSW	19	50,220,753 (GRCm39)	missense	possibly damaging	0.92
R9203:Sorcs1	UTSW	19	50,250,733 (GRCm39)	missense	probably damaging	1.00
R9229:Sorcs1	UTSW	19	50,141,300 (GRCm39)	missense	probably benign	0.17
R9398:Sorcs1	UTSW	19	50,213,651 (GRCm39)	missense	possibly damaging	0.90
R9430:Sorcs1	UTSW	19	50,199,208 (GRCm39)	missense	probably damaging	1.00
R9510:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9511:Sorcs1	UTSW	19	50,666,521 (GRCm39)	missense	probably benign	0.04
R9744:Sorcs1	UTSW	19	50,215,275 (GRCm39)	missense	probably damaging	1.00
R9777:Sorcs1	UTSW	19	50,248,190 (GRCm39)	critical splice donor site	probably null
X0024:Sorcs1	UTSW	19	50,171,201 (GRCm39)	missense	possibly damaging	0.92
Z1088:Sorcs1	UTSW	19	50,210,581 (GRCm39)	missense	probably benign	0.16
Z1177:Sorcs1	UTSW	19	50,322,037 (GRCm39)	missense	probably damaging	1.00
Z1177:Sorcs1	UTSW	19	50,215,180 (GRCm39)	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTATCCCCATAACCTTGCAC -3'
(R):5'- TCCTAGAAGACTTAAGCATTTAGGC -3'

Sequencing Primer
(F):5'- CATGCTAAATGTTTAATGGCAGC -3'
(R):5'- TCTTGGGTATGTCCCCA -3'

Posted On

2015-05-14