Incidental Mutation 'R0389:Pcdhb10'
ID31546
Institutional Source Beutler Lab
Gene Symbol Pcdhb10
Ensembl Gene ENSMUSG00000045657
Gene Nameprotocadherin beta 10
SynonymsPcdhb5D, PcdhbJ
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37411664-37414514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37412432 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 187 (D187A)
Ref Sequence ENSEMBL: ENSMUSP00000056420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051126] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051126
AA Change: D187A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000056420
Gene: ENSMUSG00000045657
AA Change: D187A

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 5.5e-33 PFAM
CA 155 240 5.59e-23 SMART
CA 264 344 5.17e-27 SMART
CA 367 448 5.59e-23 SMART
CA 472 558 6.62e-25 SMART
CA 588 669 2.03e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Pcdhb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Pcdhb10 APN 18 37412195 missense probably damaging 0.96
IGL01383:Pcdhb10 APN 18 37413275 missense probably benign 0.14
IGL01765:Pcdhb10 APN 18 37414019 missense probably benign 0.00
IGL02240:Pcdhb10 APN 18 37412402 missense possibly damaging 0.90
IGL02548:Pcdhb10 APN 18 37412690 missense probably benign 0.00
IGL02563:Pcdhb10 APN 18 37413073 missense probably benign 0.26
IGL02598:Pcdhb10 APN 18 37413781 missense possibly damaging 0.89
IGL02711:Pcdhb10 APN 18 37412726 missense possibly damaging 0.56
IGL02813:Pcdhb10 APN 18 37413762 missense possibly damaging 0.94
IGL02893:Pcdhb10 APN 18 37413634 missense probably damaging 1.00
IGL03288:Pcdhb10 APN 18 37413305 missense probably damaging 1.00
IGL03310:Pcdhb10 APN 18 37412321 missense probably damaging 0.97
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0443:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0480:Pcdhb10 UTSW 18 37413099 missense probably damaging 1.00
R1218:Pcdhb10 UTSW 18 37413161 missense probably damaging 1.00
R1448:Pcdhb10 UTSW 18 37412503 missense possibly damaging 0.89
R1737:Pcdhb10 UTSW 18 37412956 missense probably benign 0.01
R2092:Pcdhb10 UTSW 18 37414187 missense probably benign 0.00
R2277:Pcdhb10 UTSW 18 37412624 missense possibly damaging 0.82
R2363:Pcdhb10 UTSW 18 37414137 nonsense probably null
R3826:Pcdhb10 UTSW 18 37412417 missense probably damaging 1.00
R4372:Pcdhb10 UTSW 18 37413313 missense possibly damaging 0.95
R4412:Pcdhb10 UTSW 18 37414141 frame shift probably null
R4760:Pcdhb10 UTSW 18 37411942 missense probably benign 0.05
R4941:Pcdhb10 UTSW 18 37412834 missense probably benign 0.29
R5271:Pcdhb10 UTSW 18 37413169 missense probably benign 0.44
R5643:Pcdhb10 UTSW 18 37413166 missense possibly damaging 0.63
R5851:Pcdhb10 UTSW 18 37412758 missense probably benign 0.00
R6089:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6125:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6189:Pcdhb10 UTSW 18 37412403 missense probably damaging 0.99
R6414:Pcdhb10 UTSW 18 37413845 missense possibly damaging 0.95
R6731:Pcdhb10 UTSW 18 37413476 missense probably benign 0.02
R6999:Pcdhb10 UTSW 18 37413118 missense probably damaging 1.00
R7019:Pcdhb10 UTSW 18 37413003 missense probably damaging 1.00
R7317:Pcdhb10 UTSW 18 37413026 missense possibly damaging 0.67
X0024:Pcdhb10 UTSW 18 37412998 missense probably benign 0.12
X0036:Pcdhb10 UTSW 18 37411973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGTTCCCTGACCGGAAAATG -3'
(R):5'- ACTGTGGCAACTAAGGCATCAAGG -3'

Sequencing Primer
(F):5'- TGCTACTGAAAATCCCTGAGAG -3'
(R):5'- ATCTGCACCTCATAGAGTGACTG -3'
Posted On2013-04-24