Incidental Mutation 'R4156:Oog2'
ID315532
Institutional Source Beutler Lab
Gene Symbol Oog2
Ensembl Gene ENSMUSG00000066030
Gene Nameoogenesin 2
Synonyms
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4156 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144190719-144196934 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 144193953 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080405] [ENSMUST00000143978]
Predicted Effect probably benign
Transcript: ENSMUST00000080405
SMART Domains Protein: ENSMUSP00000079267
Gene: ENSMUSG00000066030

DomainStartEndE-ValueType
SCOP:d1a4ya_ 204 391 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141847
Predicted Effect probably benign
Transcript: ENSMUST00000143978
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Oog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Oog2 APN 4 144195172 missense probably damaging 1.00
IGL01317:Oog2 APN 4 144195267 missense probably benign 0.16
IGL01697:Oog2 APN 4 144195184 missense possibly damaging 0.90
IGL02237:Oog2 APN 4 144196446 missense possibly damaging 0.95
IGL02411:Oog2 APN 4 144195048 missense probably damaging 0.99
IGL02476:Oog2 APN 4 144195229 missense probably benign 0.02
IGL03284:Oog2 APN 4 144196607 unclassified probably benign
IGL03394:Oog2 APN 4 144194006 missense probably benign 0.17
R0538:Oog2 UTSW 4 144196084 nonsense probably null
R0892:Oog2 UTSW 4 144196499 missense probably benign 0.00
R1024:Oog2 UTSW 4 144196286 missense probably damaging 1.00
R4157:Oog2 UTSW 4 144193953 intron probably benign
R4166:Oog2 UTSW 4 144194841 missense probably damaging 1.00
R4167:Oog2 UTSW 4 144196212 missense probably benign 0.18
R4732:Oog2 UTSW 4 144193941 intron probably benign
R4734:Oog2 UTSW 4 144196451 missense probably benign 0.00
R4741:Oog2 UTSW 4 144195145 missense possibly damaging 0.94
R4909:Oog2 UTSW 4 144195099 missense possibly damaging 0.78
R4954:Oog2 UTSW 4 144190732 start gained probably benign
R6437:Oog2 UTSW 4 144195108 unclassified probably null
R6487:Oog2 UTSW 4 144196485 missense possibly damaging 0.48
R6946:Oog2 UTSW 4 144196464 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGATTAGACATATTATGGTGGCACAG -3'
(R):5'- TGCCTCCTTAAACATCACTGGG -3'

Sequencing Primer
(F):5'- ACATGTAATCTCAGCACTTGGC -3'
(R):5'- CATCACTGGGAACATCATATTGGGC -3'
Posted On2015-05-14