Incidental Mutation 'R4156:Ylpm1'
ID315550
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission 040862-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4156 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 85057403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably benign
Transcript: ENSMUST00000021670
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164558
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167838
Predicted Effect probably benign
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169150
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (44/46)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T A 3: 145,938,263 F69I possibly damaging Het
Acot12 C T 13: 91,784,763 L552F probably benign Het
Aff4 T A 11: 53,410,899 probably benign Het
Aldh18a1 A G 19: 40,551,281 V750A probably damaging Het
Anapc1 A G 2: 128,627,229 probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Bcl11b A T 12: 107,917,425 probably null Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Ddx20 G T 3: 105,678,933 Q699K probably benign Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Ffar2 T A 7: 30,819,668 Y149F probably damaging Het
Gamt T A 10: 80,260,724 R60* probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm6871 T C 7: 41,546,086 N302S probably damaging Het
Hps3 A G 3: 20,029,229 S135P probably damaging Het
Ifi203 T A 1: 173,936,540 N122I probably damaging Het
Leng9 T C 7: 4,149,434 D81G possibly damaging Het
Lrrc23 T A 6: 124,770,841 K262* probably null Het
Morc2b T A 17: 33,138,427 T124S probably benign Het
Mroh1 G A 15: 76,402,126 probably null Het
Naxe T C 3: 88,056,704 K240R probably benign Het
Ncan C A 8: 70,110,077 E510D possibly damaging Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Olfr1062 C A 2: 86,423,200 V159L possibly damaging Het
Olfr1098 T C 2: 86,922,878 Y218C probably damaging Het
Olfr186 A T 16: 59,027,568 F113Y probably damaging Het
Oog2 A G 4: 144,193,953 probably benign Het
Papola G A 12: 105,800,751 probably null Het
Plec A G 15: 76,172,253 S4517P probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Rxfp2 G A 5: 150,051,555 V210I probably benign Het
Ryr3 T C 2: 112,653,675 D3909G probably damaging Het
Spata31d1a T A 13: 59,705,047 K76N possibly damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Trim33 G T 3: 103,310,314 V192L possibly damaging Het
Trpm5 G T 7: 143,089,055 L52I probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Vmn1r63 T C 7: 5,803,532 T34A possibly damaging Het
Vmn2r50 T C 7: 10,040,382 K529R probably benign Het
Vmn2r9 T C 5: 108,847,877 T302A possibly damaging Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5748:Ylpm1 UTSW 12 85060251 splice site probably null
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGATCTTAGTGAGCCAACAC -3'
(R):5'- GGCTATACCACATACCTGCTGG -3'

Sequencing Primer
(F):5'- GTGAGCCAACACTTTCTTAAATGC -3'
(R):5'- CACCCACAGATAGATGAGT -3'
Posted On2015-05-14