Incidental Mutation 'R4157:Zfp398'
ID315576
Institutional Source Beutler Lab
Gene Symbol Zfp398
Ensembl Gene ENSMUSG00000062519
Gene Namezinc finger protein 398
Synonyms
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47835661-47873537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47835909 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 5 (T5S)
Ref Sequence ENSEMBL: ENSMUSP00000078806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079881] [ENSMUST00000114598]
Predicted Effect probably benign
Transcript: ENSMUST00000079881
AA Change: T5S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078806
Gene: ENSMUSG00000062519
AA Change: T5S

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:DUF3669 43 113 2.9e-10 PFAM
KRAB 143 203 1.38e-17 SMART
low complexity region 278 296 N/A INTRINSIC
ZnF_C2H2 344 365 6.31e1 SMART
ZnF_C2H2 399 421 3.58e-2 SMART
ZnF_C2H2 428 450 1.36e-2 SMART
ZnF_C2H2 456 478 1.69e-3 SMART
ZnF_C2H2 484 506 2.24e-3 SMART
ZnF_C2H2 512 534 6.78e-3 SMART
ZnF_C2H2 540 562 9.08e-4 SMART
ZnF_C2H2 568 591 5.14e-3 SMART
low complexity region 598 611 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000114598
AA Change: T5S
SMART Domains Protein: ENSMUSP00000110245
Gene: ENSMUSG00000062519
AA Change: T5S

DomainStartEndE-ValueType
KRAB 11 71 1.38e-17 SMART
low complexity region 146 164 N/A INTRINSIC
ZnF_C2H2 212 233 6.31e1 SMART
ZnF_C2H2 267 289 3.58e-2 SMART
ZnF_C2H2 296 318 1.36e-2 SMART
ZnF_C2H2 324 346 1.69e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 6.78e-3 SMART
ZnF_C2H2 408 430 9.08e-4 SMART
ZnF_C2H2 436 459 5.14e-3 SMART
low complexity region 466 479 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146202
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel family of C2H2-type zinc-finger transcription factor proteins. The encoded protein acts as a transcriptional activator. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described, but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in Zfp398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Zfp398 APN 6 47865934 missense probably benign
IGL01543:Zfp398 APN 6 47866063 missense probably damaging 1.00
IGL01822:Zfp398 APN 6 47866271 missense probably damaging 1.00
IGL02118:Zfp398 APN 6 47858945 missense probably damaging 1.00
IGL02454:Zfp398 APN 6 47840367 missense possibly damaging 0.93
IGL02725:Zfp398 APN 6 47865803 missense probably benign 0.00
R0453:Zfp398 UTSW 6 47865848 missense probably benign 0.01
R0635:Zfp398 UTSW 6 47863140 missense probably damaging 1.00
R1759:Zfp398 UTSW 6 47859478 missense possibly damaging 0.92
R2366:Zfp398 UTSW 6 47863209 missense possibly damaging 0.93
R2696:Zfp398 UTSW 6 47866945 makesense probably null
R4090:Zfp398 UTSW 6 47866225 missense probably damaging 1.00
R4610:Zfp398 UTSW 6 47840427 missense probably damaging 1.00
R4784:Zfp398 UTSW 6 47840252 missense probably benign
R4849:Zfp398 UTSW 6 47859512 missense possibly damaging 0.79
R5166:Zfp398 UTSW 6 47865904 missense probably benign
R5289:Zfp398 UTSW 6 47863181 missense probably benign
R5877:Zfp398 UTSW 6 47840704 intron probably benign
R6326:Zfp398 UTSW 6 47866421 missense possibly damaging 0.90
R6383:Zfp398 UTSW 6 47866595 missense probably damaging 1.00
R6825:Zfp398 UTSW 6 47866331 missense probably damaging 1.00
R6882:Zfp398 UTSW 6 47866082 missense probably damaging 0.99
R7038:Zfp398 UTSW 6 47866309 missense probably damaging 1.00
R7114:Zfp398 UTSW 6 47865976 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTACTCGCTGCCCACAAAG -3'
(R):5'- GTGTAGGTTAGAAACTGCAGACC -3'

Sequencing Primer
(F):5'- TAGGCTGCTCGCTACTCAG -3'
(R):5'- GTTAGAAACTGCAGACCCTGGTC -3'
Posted On2015-05-14