Incidental Mutation 'R4157:1700123L14Rik'
List |< first << previous [record 7 of 1871] next >> last >|
ID315577
Institutional Source Beutler Lab
Gene Symbol 1700123L14Rik
Ensembl Gene ENSMUSG00000072878
Gene NameRIKEN cDNA 1700123L14 gene
Synonyms
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R4157 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location96164497-96166243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 96165283 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Serine at position 260 (W260S)
Ref Sequence ENSEMBL: ENSMUSP00000087515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075080] [ENSMUST00000090061] [ENSMUST00000122120]
Predicted Effect probably benign
Transcript: ENSMUST00000075080
SMART Domains Protein: ENSMUSP00000074589
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 40 129 3.9e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090061
AA Change: W260S

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087515
Gene: ENSMUSG00000072878
AA Change: W260S

DomainStartEndE-ValueType
Pfam:NUP50 2 73 1.8e-15 PFAM
low complexity region 84 94 N/A INTRINSIC
RanBD 315 438 2.69e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122120
SMART Domains Protein: ENSMUSP00000113152
Gene: ENSMUSG00000059187

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:TAFA 41 129 4e-50 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Ccpg1 C A 9: 73,012,167 Q355K probably benign Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in 1700123L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:1700123L14Rik APN 6 96165694 missense possibly damaging 0.48
IGL02347:1700123L14Rik APN 6 96165530 missense probably damaging 1.00
IGL02532:1700123L14Rik APN 6 96164790 missense probably damaging 0.99
R0282:1700123L14Rik UTSW 6 96164816 missense probably benign 0.02
R0946:1700123L14Rik UTSW 6 96165696 missense possibly damaging 0.68
R1275:1700123L14Rik UTSW 6 96165118 missense probably benign 0.03
R1605:1700123L14Rik UTSW 6 96164812 missense probably benign 0.34
R1610:1700123L14Rik UTSW 6 96165289 missense probably damaging 0.98
R1959:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R1961:1700123L14Rik UTSW 6 96165269 missense possibly damaging 0.73
R2116:1700123L14Rik UTSW 6 96164860 missense probably damaging 0.99
R3708:1700123L14Rik UTSW 6 96165952 missense possibly damaging 0.92
R4285:1700123L14Rik UTSW 6 96165752 missense probably benign 0.07
R4571:1700123L14Rik UTSW 6 96164881 missense probably damaging 1.00
R4884:1700123L14Rik UTSW 6 96164812 missense probably damaging 1.00
R4905:1700123L14Rik UTSW 6 96165930 missense possibly damaging 0.77
R6454:1700123L14Rik UTSW 6 96165628 missense possibly damaging 0.75
R6755:1700123L14Rik UTSW 6 96164972 missense probably benign 0.06
R6790:1700123L14Rik UTSW 6 96165323 missense probably benign
R6792:1700123L14Rik UTSW 6 96165115 missense possibly damaging 0.92
R6931:1700123L14Rik UTSW 6 96165548 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACACTTCTTGCAGTAGAAAGCAC -3'
(R):5'- TCTCAGAAAGCGAGCCTAAC -3'

Sequencing Primer
(F):5'- GAAAGCACTTTCCTCCTCCTC -3'
(R):5'- CCTAACCGGGGCTTTGTTGC -3'
Posted On2015-05-14