Incidental Mutation 'R4157:Ccpg1'
ID315584
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Namecell cycle progression 1
Synonyms1700030B06Rik, D9Ertd392e, 1810073J13Rik, 9430028F23Rik
MMRRC Submission 041000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4157 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72985429-73016340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73012167 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 355 (Q355K)
Ref Sequence ENSEMBL: ENSMUSP00000122966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000093819] [ENSMUST00000098566] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably benign
Transcript: ENSMUST00000037977
AA Change: Q355K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085350
AA Change: Q355K

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093819
Predicted Effect probably benign
Transcript: ENSMUST00000098566
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124008
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138466
Predicted Effect probably benign
Transcript: ENSMUST00000140675
AA Change: Q355K

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150826
AA Change: Q355K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: Q355K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183746
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184035
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184389
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik C G 6: 96,165,283 W260S possibly damaging Het
Adamts7 G T 9: 90,188,361 R585L probably damaging Het
Adamtsl5 C T 10: 80,345,322 R75Q probably null Het
Ankrd26 T A 6: 118,507,821 Q1485L probably damaging Het
Apbb2 G A 5: 66,302,604 R717* probably null Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp8b5 A G 4: 43,365,591 E735G probably damaging Het
Bcl11b A T 12: 107,917,425 probably null Het
C4b A G 17: 34,742,855 I139T probably damaging Het
Cdk8 A T 5: 146,299,449 probably benign Het
Ctif T C 18: 75,435,270 H599R probably benign Het
Degs1 A G 1: 182,282,627 I26T possibly damaging Het
Dnajc4 T C 19: 6,989,840 N72S probably damaging Het
Ecd A G 14: 20,324,564 S503P probably damaging Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm3486 G A 14: 41,486,386 L123F probably benign Het
Inpp5f C T 7: 128,679,699 probably benign Het
Irx4 A T 13: 73,265,543 Q44L probably benign Het
Krt9 T A 11: 100,188,649 Y639F unknown Het
Lgals9 C A 11: 78,973,107 V71L possibly damaging Het
Mdga1 T C 17: 29,833,343 N143S probably benign Het
Ndufs4 A T 13: 114,307,854 S129R probably benign Het
Oog2 A G 4: 144,193,953 probably benign Het
Orm2 T A 4: 63,363,985 F133L probably null Het
Pidd1 A G 7: 141,441,366 V333A possibly damaging Het
Ppp4r3a A G 12: 101,055,619 F341L probably damaging Het
Rab11fip1 A T 8: 27,152,147 S875T probably damaging Het
Rpap1 C T 2: 119,774,179 R416H probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx22 T C 9: 66,068,211 Y92C probably damaging Het
Srgn A G 10: 62,497,834 F55L possibly damaging Het
Swt1 A T 1: 151,403,044 V454E probably damaging Het
Tmem54 G A 4: 129,110,711 R151Q probably damaging Het
Tns1 T A 1: 73,914,631 N1848Y probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top2b A G 14: 16,384,491 N80S probably benign Het
Trim7 T C 11: 48,848,093 V313A probably benign Het
Uaca A G 9: 60,871,753 S1141G probably benign Het
Ubr3 T C 2: 69,959,669 probably null Het
Utp20 A G 10: 88,761,867 V121A probably benign Het
Wdr20 G A 12: 110,738,174 R49H possibly damaging Het
Ylpm1 T C 12: 85,057,403 probably benign Het
Zfp398 A T 6: 47,835,909 T5S probably benign Het
Zfp410 G A 12: 84,327,432 R181H probably damaging Het
Zfp523 C T 17: 28,202,283 A367V probably benign Het
Zfp748 G A 13: 67,542,106 S345L possibly damaging Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 73005877 missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72997441 utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72997453 missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 73001877 critical splice donor site probably null
R0586:Ccpg1 UTSW 9 73001821 missense probably benign 0.00
R1188:Ccpg1 UTSW 9 73012506 missense possibly damaging 0.55
R1503:Ccpg1 UTSW 9 72999478 missense probably benign 0.00
R1599:Ccpg1 UTSW 9 72999125 nonsense probably null
R2130:Ccpg1 UTSW 9 73013158 missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 73013106 missense probably benign 0.00
R3052:Ccpg1 UTSW 9 73005868 missense probably damaging 1.00
R4155:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4156:Ccpg1 UTSW 9 73012167 missense probably benign 0.38
R4257:Ccpg1 UTSW 9 73012627 missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 73015915 intron probably benign
R5081:Ccpg1 UTSW 9 72999078 missense possibly damaging 0.94
R5227:Ccpg1 UTSW 9 73012072 nonsense probably null
R5288:Ccpg1 UTSW 9 73013044 missense probably benign
R5385:Ccpg1 UTSW 9 73013044 missense probably benign
R5386:Ccpg1 UTSW 9 73013044 missense probably benign
R5412:Ccpg1 UTSW 9 73010306 missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 73013244 missense possibly damaging 0.78
R6230:Ccpg1 UTSW 9 73012356 missense probably benign 0.00
R7269:Ccpg1 UTSW 9 73013327 missense probably benign 0.06
R7287:Ccpg1 UTSW 9 73015406 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGGACCGTTACTGAATCAGAG -3'
(R):5'- TCTGCACACTAGGAGACTCC -3'

Sequencing Primer
(F):5'- CCGTTACTGAATCAGAGAAGATTACC -3'
(R):5'- ACTAGGAGACTCCGCACG -3'
Posted On2015-05-14