Incidental Mutation 'R4158:Efcab14'
ID315619
Institutional Source Beutler Lab
Gene Symbol Efcab14
Ensembl Gene ENSMUSG00000034210
Gene NameEF-hand calcium binding domain 14
Synonyms
MMRRC Submission 041001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R4158 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115737744-115777327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115740397 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 63 (D63A)
Ref Sequence ENSEMBL: ENSMUSP00000074025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074425] [ENSMUST00000106522] [ENSMUST00000106524] [ENSMUST00000106525]
Predicted Effect probably damaging
Transcript: ENSMUST00000074425
AA Change: D63A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074025
Gene: ENSMUSG00000034210
AA Change: D63A

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1fi6a_ 425 498 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106522
AA Change: D63A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102132
Gene: ENSMUSG00000034210
AA Change: D63A

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106524
AA Change: D63A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102134
Gene: ENSMUSG00000034210
AA Change: D63A

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 360 418 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106525
AA Change: D63A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102135
Gene: ENSMUSG00000034210
AA Change: D63A

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
SCOP:d1hqva_ 424 482 3e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136593
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,650,817 H597R probably damaging Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arg1 T C 10: 24,922,677 E25G probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Bsn A G 9: 108,112,946 V1869A possibly damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
Dnajc13 G A 9: 104,190,442 L1173F probably damaging Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Eomes A G 9: 118,478,963 T35A probably benign Het
Fbxl20 T C 11: 98,095,394 probably benign Het
Flcn T C 11: 59,801,121 N234S probably benign Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Iltifb T C 10: 118,293,132 T151A probably damaging Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrrc45 A T 11: 120,718,446 D377V possibly damaging Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Mocos T C 18: 24,674,246 I345T probably damaging Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Sec31b T C 19: 44,525,186 N470S probably benign Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tex14 T G 11: 87,516,769 S900R probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Zfp981 C A 4: 146,537,623 P335Q probably benign Het
Zfp981 T A 4: 146,537,882 H421Q probably benign Het
Other mutations in Efcab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Efcab14 APN 4 115760064 splice site probably benign
IGL02300:Efcab14 APN 4 115758896 critical splice donor site probably null
IGL02598:Efcab14 APN 4 115740434 nonsense probably null
IGL02680:Efcab14 APN 4 115740418 missense probably damaging 1.00
IGL03066:Efcab14 APN 4 115738804 missense probably benign 0.12
R0123:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R0134:Efcab14 UTSW 4 115740531 missense probably damaging 1.00
R1275:Efcab14 UTSW 4 115756473 missense probably damaging 1.00
R1481:Efcab14 UTSW 4 115756517 missense probably benign 0.07
R1590:Efcab14 UTSW 4 115756549 splice site probably benign
R1694:Efcab14 UTSW 4 115746539 missense possibly damaging 0.82
R1768:Efcab14 UTSW 4 115752919 critical splice acceptor site probably null
R1769:Efcab14 UTSW 4 115752991 missense probably damaging 1.00
R3887:Efcab14 UTSW 4 115738660 start codon destroyed probably null 1.00
R4160:Efcab14 UTSW 4 115740397 missense probably damaging 0.99
R5584:Efcab14 UTSW 4 115764597 missense possibly damaging 0.49
R5690:Efcab14 UTSW 4 115760047 missense possibly damaging 0.71
R5796:Efcab14 UTSW 4 115746583 missense probably damaging 0.99
R5945:Efcab14 UTSW 4 115756467 missense probably damaging 1.00
R6445:Efcab14 UTSW 4 115756471 missense possibly damaging 0.74
R6761:Efcab14 UTSW 4 115738827 missense probably damaging 1.00
X0018:Efcab14 UTSW 4 115766486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACCCCGTAGAACTTTTCACGG -3'
(R):5'- TTCAGCATGGGCCAGTTTCC -3'

Sequencing Primer
(F):5'- CGTAGAACTTTTCACGGGTCATATTC -3'
(R):5'- GTTTCCCCCAAGACTTGAAGAG -3'
Posted On2015-05-14