Incidental Mutation 'R4160:Pdia3'
ID315687
Institutional Source Beutler Lab
Gene Symbol Pdia3
Ensembl Gene ENSMUSG00000027248
Gene Nameprotein disulfide isomerase associated 3
SynonymsERp61, Plca, PDI, Grp58, Erp, PDI-Q2, ERp57, ERp60
MMRRC Submission 041003-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4160 (G1)
Quality Score188
Status Validated
Chromosome2
Chromosomal Location121413775-121438687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121414115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 26 (D26V)
Ref Sequence ENSEMBL: ENSMUSP00000028683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028683] [ENSMUST00000038073] [ENSMUST00000135079] [ENSMUST00000154604]
Predicted Effect probably damaging
Transcript: ENSMUST00000028683
AA Change: D26V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028683
Gene: ENSMUSG00000027248
AA Change: D26V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Thioredoxin 26 131 5.2e-36 PFAM
Pfam:Thioredoxin_6 160 355 2e-29 PFAM
Pfam:Thioredoxin 377 483 9.5e-33 PFAM
low complexity region 487 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038073
SMART Domains Protein: ENSMUSP00000037222
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Pfam:Ion_trans 105 350 1e-35 PFAM
low complexity region 422 447 N/A INTRINSIC
internal_repeat_1 450 473 3.72e-11 PROSPERO
internal_repeat_1 465 488 3.72e-11 PROSPERO
low complexity region 491 502 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123982
Predicted Effect possibly damaging
Transcript: ENSMUST00000135079
AA Change: D3V

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119337
Gene: ENSMUSG00000027248
AA Change: D3V

DomainStartEndE-ValueType
Pfam:Thioredoxin 3 105 5.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153378
Predicted Effect probably benign
Transcript: ENSMUST00000154604
SMART Domains Protein: ENSMUSP00000119091
Gene: ENSMUSG00000033486

DomainStartEndE-ValueType
low complexity region 78 91 N/A INTRINSIC
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of the endoplasmic reticulum that interacts with lectin chaperones calreticulin and calnexin to modulate folding of newly synthesized glycoproteins. The protein was once thought to be a phospholipase; however, it has been demonstrated that the protein actually has protein disulfide isomerase activity. It is thought that complexes of lectins and this protein mediate protein folding by promoting formation of disulfide bonds in their glycoprotein substrates. This protein also functions as a molecular chaperone that prevents the formation of protein aggregates. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die by E13.5 with minor changes in ER calcium capacity and unfolded protein response in mouse embryonic fibroblasts. Mice homozygous for a gene trap allele die prior to birth while heterozygous mice exhibit abnormalbone volume bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Adgrf4 G T 17: 42,667,677 H258Q probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Cacnb3 G T 15: 98,640,720 G148C probably damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
D130043K22Rik A C 13: 24,862,696 E360D probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Ibtk T C 9: 85,703,090 E1167G probably benign Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Myh13 T C 11: 67,364,810 probably benign Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Pkn2 G A 3: 142,803,564 P740S probably benign Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Pld2 T C 11: 70,541,427 L124P probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Prr36 G T 8: 4,212,910 Q919K probably benign Het
Ptpn1 T C 2: 167,967,811 I113T probably benign Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Rbl1 A G 2: 157,192,119 probably benign Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Pdia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pdia3 APN 2 121414178 missense probably damaging 1.00
IGL00777:Pdia3 APN 2 121429556 missense probably damaging 1.00
IGL02020:Pdia3 APN 2 121436419 splice site probably null
IGL02437:Pdia3 APN 2 121433648 missense probably damaging 1.00
IGL02988:Pdia3 UTSW 2 121429556 missense probably damaging 1.00
PIT4812001:Pdia3 UTSW 2 121433530 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0242:Pdia3 UTSW 2 121414111 missense probably damaging 1.00
R0606:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0612:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0658:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0724:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0730:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0880:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R0882:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1157:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1160:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1238:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1619:Pdia3 UTSW 2 121432377 missense probably damaging 1.00
R1853:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R1854:Pdia3 UTSW 2 121431663 missense probably benign 0.20
R2014:Pdia3 UTSW 2 121434820 missense probably damaging 1.00
R2103:Pdia3 UTSW 2 121433993 missense probably damaging 1.00
R4628:Pdia3 UTSW 2 121414139 missense possibly damaging 0.91
R5032:Pdia3 UTSW 2 121414139 missense probably benign 0.28
R5279:Pdia3 UTSW 2 121414003 unclassified probably benign
R5598:Pdia3 UTSW 2 121414130 missense possibly damaging 0.53
R5815:Pdia3 UTSW 2 121436411 nonsense probably null
R7162:Pdia3 UTSW 2 121429521 missense probably benign 0.00
X0012:Pdia3 UTSW 2 121435945 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATCGGCAGTTACCAGCTGTTC -3'
(R):5'- ACCCTGGAGTTTAGGCTTTC -3'

Sequencing Primer
(F):5'- CGTGACGCAGCCAATCG -3'
(R):5'- AGCCAGGCCTGCTAGATAGTG -3'
Posted On2015-05-14