Incidental Mutation 'R4160:Adgrf4'
ID315718
Institutional Source Beutler Lab
Gene Symbol Adgrf4
Ensembl Gene ENSMUSG00000023918
Gene Nameadhesion G protein-coupled receptor F4
Synonyms4632435A09Rik, Gpr115
MMRRC Submission 041003-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4160 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42656891-42692284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42667677 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 258 (H258Q)
Ref Sequence ENSEMBL: ENSMUSP00000133261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024711] [ENSMUST00000164524] [ENSMUST00000167993] [ENSMUST00000170723]
Predicted Effect probably benign
Transcript: ENSMUST00000024711
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024711
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164524
SMART Domains Protein: ENSMUSP00000129114
Gene: ENSMUSG00000023918

DomainStartEndE-ValueType
SCOP:g1qd6.1 20 44 1e-2 SMART
low complexity region 54 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167993
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132890
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170723
AA Change: H258Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133261
Gene: ENSMUSG00000023918
AA Change: H258Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 103 112 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
GPS 349 400 1.25e-8 SMART
Pfam:7tm_2 402 653 9.2e-36 PFAM
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sequence analysis of this gene suggests that it is encodes a member of the superfamily of G protein-couple receptors. G protein-coupled receptors typically contain seven hydrophobic transmembrane domains, interact with guanine nucleotide binding regulatory proteins, and detect molecules outside the cell and act to transduce these signals into intracellular responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
Ankrd1 T A 19: 36,117,873 K138N probably damaging Het
Arhgef19 T C 4: 141,246,349 I49T possibly damaging Het
Cacnb3 G T 15: 98,640,720 G148C probably damaging Het
Cep350 G A 1: 155,932,875 R652W probably damaging Het
Cyp19a1 G A 9: 54,186,696 T94I probably damaging Het
D130043K22Rik A C 13: 24,862,696 E360D probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Efcab14 A C 4: 115,740,397 D63A probably damaging Het
Ibtk T C 9: 85,703,090 E1167G probably benign Het
Ikzf4 A T 10: 128,643,736 probably benign Het
Magi3 T C 3: 104,050,961 K603E probably damaging Het
Myh13 T C 11: 67,364,810 probably benign Het
Nox4 A T 7: 87,396,824 H557L possibly damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pdia3 A T 2: 121,414,115 D26V probably damaging Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Pkn2 G A 3: 142,803,564 P740S probably benign Het
Pla2r1 A T 2: 60,422,622 I1375K probably damaging Het
Pld2 T C 11: 70,541,427 L124P probably damaging Het
Ppp6r3 T A 19: 3,512,037 H208L probably damaging Het
Prr36 G T 8: 4,212,910 Q919K probably benign Het
Ptpn1 T C 2: 167,967,811 I113T probably benign Het
Ptprz1 T C 6: 23,022,205 I844T possibly damaging Het
Rbl1 A G 2: 157,192,119 probably benign Het
Sdk1 A G 5: 142,114,399 I1395V probably benign Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc26a7 T C 4: 14,544,197 T369A probably benign Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Vat1l T A 8: 114,371,729 M413K probably benign Het
Vps11 C G 9: 44,355,720 G406A probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Adgrf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adgrf4 APN 17 42666656 missense probably damaging 1.00
IGL00474:Adgrf4 APN 17 42675759 missense probably damaging 0.97
IGL00913:Adgrf4 APN 17 42666902 missense possibly damaging 0.81
IGL02134:Adgrf4 APN 17 42669690 missense probably damaging 1.00
IGL02225:Adgrf4 APN 17 42663378 critical splice donor site probably null
IGL02423:Adgrf4 APN 17 42672576 missense probably benign 0.06
IGL02945:Adgrf4 APN 17 42667366 missense probably benign
R0329:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R0330:Adgrf4 UTSW 17 42667313 missense probably damaging 1.00
R1595:Adgrf4 UTSW 17 42667873 missense probably benign 0.09
R1739:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1762:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1783:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R1785:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2038:Adgrf4 UTSW 17 42667863 missense probably damaging 1.00
R2069:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2140:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2142:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2230:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2232:Adgrf4 UTSW 17 42666898 missense possibly damaging 0.93
R2288:Adgrf4 UTSW 17 42667511 missense probably benign
R3107:Adgrf4 UTSW 17 42666867 nonsense probably null
R3732:Adgrf4 UTSW 17 42672581 missense probably damaging 1.00
R4003:Adgrf4 UTSW 17 42669759 missense probably damaging 1.00
R4158:Adgrf4 UTSW 17 42667677 missense probably benign
R4163:Adgrf4 UTSW 17 42667586 missense probably benign
R4865:Adgrf4 UTSW 17 42667265 missense probably damaging 1.00
R4940:Adgrf4 UTSW 17 42666529 missense possibly damaging 0.90
R5411:Adgrf4 UTSW 17 42667213 missense probably damaging 1.00
R5512:Adgrf4 UTSW 17 42667285 missense probably benign 0.03
R6421:Adgrf4 UTSW 17 42672501 missense probably damaging 1.00
R7089:Adgrf4 UTSW 17 42666533 missense possibly damaging 0.95
R7261:Adgrf4 UTSW 17 42667435 missense probably benign 0.01
R7359:Adgrf4 UTSW 17 42667112 missense possibly damaging 0.78
X0027:Adgrf4 UTSW 17 42667528 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCAGACCTTCTGGCAAAACC -3'
(R):5'- ACTGCCATTTCAAATTGGGC -3'

Sequencing Primer
(F):5'- AGGTCATCTATAGGCTTTTGGAG -3'
(R):5'- GCCATTTCAAATTGGGCTTTCATTG -3'
Posted On2015-05-14