Incidental Mutation 'R3921:St7'
ID315735
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Namesuppression of tumorigenicity 7
SynonymsRAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17692933-17943025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17846245 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 120 (N120D)
Ref Sequence ENSEMBL: ENSMUSP00000076334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]
Predicted Effect probably benign
Transcript: ENSMUST00000000674
AA Change: N120D

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: N120D

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052113
AA Change: N166D

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: N166D

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053148
AA Change: N123D

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: N123D

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077080
AA Change: N120D

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: N120D

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081635
AA Change: N166D

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: N166D

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115417
AA Change: N123D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: N123D

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115418
AA Change: N166D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: N166D

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115419
AA Change: N166D

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: N166D

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115420
AA Change: N166D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: N166D

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127181
AA Change: E172G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144021
AA Change: E172G
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17855006 missense probably damaging 1.00
IGL01312:St7 APN 6 17922014 missense probably damaging 1.00
IGL01562:St7 APN 6 17922035 missense probably damaging 0.99
IGL01935:St7 APN 6 17930823 missense probably damaging 0.99
IGL02127:St7 APN 6 17844969 intron probably benign
IGL02954:St7 APN 6 17848031 missense probably damaging 1.00
IGL02980:St7 UTSW 6 17749546 intron probably benign
R0457:St7 UTSW 6 17819282 missense probably damaging 1.00
R0666:St7 UTSW 6 17934239 missense probably damaging 1.00
R0680:St7 UTSW 6 17942733 missense probably damaging 0.99
R1575:St7 UTSW 6 17886111 missense probably damaging 1.00
R2039:St7 UTSW 6 17886112 missense probably damaging 1.00
R2144:St7 UTSW 6 17886007 missense possibly damaging 0.58
R2194:St7 UTSW 6 17942719 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2869:St7 UTSW 6 17819277 missense probably damaging 1.00
R2873:St7 UTSW 6 17819277 missense probably damaging 1.00
R2874:St7 UTSW 6 17819277 missense probably damaging 1.00
R2970:St7 UTSW 6 17844909 missense probably damaging 1.00
R3076:St7 UTSW 6 17846238 nonsense probably null
R4326:St7 UTSW 6 17819288 missense probably damaging 1.00
R4327:St7 UTSW 6 17819288 missense probably damaging 1.00
R4410:St7 UTSW 6 17854933 nonsense probably null
R4732:St7 UTSW 6 17906516 splice site probably null
R4733:St7 UTSW 6 17906516 splice site probably null
R4868:St7 UTSW 6 17819266 missense probably damaging 1.00
R4988:St7 UTSW 6 17934226 missense probably damaging 0.99
R5132:St7 UTSW 6 17854957 missense probably damaging 0.97
R5182:St7 UTSW 6 17846237 missense probably damaging 0.99
R5195:St7 UTSW 6 17743637 intron probably benign
R5358:St7 UTSW 6 17819318 missense probably damaging 1.00
R5502:St7 UTSW 6 17834674 missense possibly damaging 0.94
R5882:St7 UTSW 6 17846249 missense probably damaging 1.00
R5976:St7 UTSW 6 17694222 missense possibly damaging 0.93
R6049:St7 UTSW 6 17694348 missense possibly damaging 0.92
R6139:St7 UTSW 6 17694354 missense probably damaging 1.00
R6177:St7 UTSW 6 17819334 critical splice donor site probably null
R6181:St7 UTSW 6 17694364 critical splice donor site probably null
R6401:St7 UTSW 6 17855318 unclassified probably null
R6546:St7 UTSW 6 17852314 missense probably damaging 1.00
R6711:St7 UTSW 6 17848070 missense possibly damaging 0.82
R6898:St7 UTSW 6 17854946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGCTGGGAATCCAACAG -3'
(R):5'- GGCAAGAACTTTACCTCCTGC -3'

Sequencing Primer
(F):5'- ATCCAACAGGAGTCCTTTGG -3'
(R):5'- AGCTGGTCTCAAACTAGATGTCC -3'
Posted On2015-05-15