Incidental Mutation 'R3921:Spg7'
ID315740
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene NameSPG7, paraplegin matrix AAA peptidase subunit
SynonymsCmar, paraplegin
MMRRC Submission 040818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3921 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123062942-123097760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 123087373 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 457 (R457P)
Ref Sequence ENSEMBL: ENSMUSP00000115039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000135991] [ENSMUST00000149248] [ENSMUST00000153285]
Predicted Effect probably damaging
Transcript: ENSMUST00000108868
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125975
AA Change: R352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: R352P

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128234
AA Change: R25P
SMART Domains Protein: ENSMUSP00000120793
Gene: ENSMUSG00000000738
AA Change: R25P

DomainStartEndE-ValueType
Pfam:AAA 1 48 5.8e-10 PFAM
Pfam:Peptidase_M41 110 222 9.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130787
Predicted Effect probably benign
Transcript: ENSMUST00000135991
SMART Domains Protein: ENSMUSP00000118066
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:Peptidase_M41 1 81 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142150
Predicted Effect probably damaging
Transcript: ENSMUST00000149248
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152972
Predicted Effect probably damaging
Transcript: ENSMUST00000153285
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153492
SMART Domains Protein: ENSMUSP00000133602
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:FtsH_ext 1 102 1.3e-12 PFAM
transmembrane domain 110 132 N/A INTRINSIC
PDB:2QZ4|A 165 192 1e-8 PDB
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,774,202 F16S probably benign Het
Aebp2 C T 6: 140,633,735 R11C probably damaging Het
Anxa8 T C 14: 34,094,446 F201L probably damaging Het
Bcl7a A G 5: 123,371,073 N206S probably benign Het
Birc6 A G 17: 74,627,019 N2542D probably damaging Het
Cubn A G 2: 13,326,677 Y2562H probably damaging Het
Dnah12 C G 14: 26,771,051 D1256E probably damaging Het
Dnajb14 A T 3: 137,904,852 R280S probably damaging Het
Dopey1 A T 9: 86,520,271 I1173F probably benign Het
Fam228a T C 12: 4,731,506 T118A probably benign Het
Gata2 TGCCATGGGCTAGGCAAGCC TGCC 6: 88,205,482 probably null Het
Gm5538 T A 3: 59,752,077 L317Q probably damaging Het
Hif3a T C 7: 17,037,172 D618G possibly damaging Het
Ighv1-43 C A 12: 114,946,152 G50V probably benign Het
Lrrc37a G T 11: 103,501,470 T1043N probably benign Het
Masp2 T A 4: 148,605,731 D232E possibly damaging Het
Ms4a4a A C 19: 11,378,808 Q19P probably benign Het
Nckipsd A G 9: 108,814,076 E399G possibly damaging Het
Nnt T A 13: 119,366,494 T572S probably damaging Het
Olfr1247 C T 2: 89,609,509 V198I probably benign Het
Olfr480 T A 7: 108,065,901 D299V possibly damaging Het
Olig3 A G 10: 19,356,675 D16G probably damaging Het
Polr2b T C 5: 77,326,653 Y446H probably damaging Het
Prtg T C 9: 72,848,347 V277A probably damaging Het
Rnf31 T C 14: 55,601,142 Y857H probably damaging Het
Serac1 T C 17: 6,066,792 D163G probably damaging Het
Slc22a22 C A 15: 57,256,544 V197F probably benign Het
Slc2a10 C T 2: 165,515,601 P394S probably benign Het
St7 A G 6: 17,846,245 N120D probably benign Het
Sult2a6 C T 7: 14,254,743 V31M possibly damaging Het
Taf3 T C 2: 10,048,298 T35A probably benign Het
Tmem131l A G 3: 83,940,601 I319T possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l T TTGGATG 15: 10,537,563 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r9 T G 5: 108,849,055 Y116S probably benign Het
Vstm2l A G 2: 157,935,363 T54A probably benign Het
Xrn1 T A 9: 95,969,284 M153K probably benign Het
Zfp106 G A 2: 120,533,616 P770L probably damaging Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3751:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3753:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5392:Spg7 UTSW 8 123087363 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 1.00
R5810:Spg7 UTSW 8 123094569 missense possibly damaging 0.94
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6750:Spg7 UTSW 8 123073911 missense probably damaging 1.00
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGAAGCCGTTGTGAAGG -3'
(R):5'- AACAGCAGAGCTTCCTGTCC -3'

Sequencing Primer
(F):5'- CTCATCGGTCTGTCCAGATGGAG -3'
(R):5'- AGAGCTTCCTGTCCCAAGCAG -3'
Posted On2015-05-15