Incidental Mutation 'R4060:Olfr342'
ID315803
Institutional Source Beutler Lab
Gene Symbol Olfr342
Ensembl Gene ENSMUSG00000111869
Gene Nameolfactory receptor 342
SynonymsMOR136-4, GA_x6K02T2NLDC-33222024-33222962
MMRRC Submission 041618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4060 (G1)
Quality Score209
Status Validated
Chromosome2
Chromosomal Location36524998-36530790 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 36527414 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000149751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074192] [ENSMUST00000216275]
Predicted Effect probably null
Transcript: ENSMUST00000074192
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073818
Gene: ENSMUSG00000111869
AA Change: M1V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-56 PFAM
Pfam:7tm_1 41 290 2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213794
Predicted Effect probably null
Transcript: ENSMUST00000216275
AA Change: M1V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.43 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Olfr342
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr342 APN 2 36527993 missense probably benign 0.22
IGL01372:Olfr342 APN 2 36527451 missense probably benign 0.00
IGL01747:Olfr342 APN 2 36527832 missense probably damaging 1.00
IGL01836:Olfr342 APN 2 36527825 nonsense probably null
IGL02409:Olfr342 APN 2 36528153 missense probably damaging 1.00
IGL02578:Olfr342 APN 2 36528144 missense probably damaging 1.00
IGL03344:Olfr342 APN 2 36528128 missense probably damaging 1.00
IGL03396:Olfr342 APN 2 36527680 missense probably benign 0.00
R0086:Olfr342 UTSW 2 36527450 missense possibly damaging 0.69
R0427:Olfr342 UTSW 2 36527982 missense probably damaging 1.00
R0973:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R0973:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R0974:Olfr342 UTSW 2 36528008 missense probably benign 0.13
R2183:Olfr342 UTSW 2 36527711 nonsense probably null
R2437:Olfr342 UTSW 2 36528246 missense probably damaging 1.00
R4982:Olfr342 UTSW 2 36527397 critical splice acceptor site probably null
R5070:Olfr342 UTSW 2 36527766 missense probably damaging 1.00
R6244:Olfr342 UTSW 2 36528341 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACCATCACTAGCCCATTATTGTG -3'
(R):5'- AGATGTCCGTGAAGGCCAAG -3'

Sequencing Primer
(F):5'- GCCCATTATTGTGACAAAAAGCTC -3'
(R):5'- CCAAGTGGCTAAGGAAGAAGTACATG -3'
Posted On2015-05-15