Incidental Mutation 'R4060:Mast3'
ID315821
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 041618-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4060 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70781194 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 969 (V969A)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: V985A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V985A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: V969A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000212140
AA Change: V220A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Abca8b A T 11: 109,957,201 M756K probably benign Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdan1 T C 2: 120,725,743 I681V probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Cfh T C 1: 140,119,926 I488M possibly damaging Het
Cntn2 T A 1: 132,525,896 L346F probably damaging Het
Creb3l2 T C 6: 37,334,549 H435R probably benign Het
Dmbt1 A G 7: 131,074,202 probably benign Het
Fam162a C T 16: 36,044,081 R38K probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Foxo1 A G 3: 52,345,162 R249G probably damaging Het
Grm6 A G 11: 50,853,224 E174G probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hypk A G 2: 121,453,679 probably benign Het
Ifih1 T C 2: 62,598,799 T932A possibly damaging Het
Igfbp1 C A 11: 7,198,091 P45T probably damaging Het
Ik A G 18: 36,748,890 K142E probably damaging Het
Ltbp3 T C 19: 5,742,320 L27P probably benign Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr342 A G 2: 36,527,414 M1V probably null Het
Olfr53 T C 7: 140,652,120 I47T probably damaging Het
Olfr832 T C 9: 18,945,050 V134A probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Pcdhb20 A G 18: 37,506,164 E581G probably damaging Het
Rnf146 T C 10: 29,347,367 I174M probably damaging Het
Serpinb9g G A 13: 33,495,106 V320I probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc23a3 T G 1: 75,133,320 probably benign Het
Ssrp1 T G 2: 85,041,634 Y401D probably damaging Het
Tas2r109 A T 6: 132,980,185 W261R probably damaging Het
Tas2r144 T C 6: 42,215,629 V101A possibly damaging Het
Tead1 T A 7: 112,876,062 probably null Het
Tiam2 A G 17: 3,428,980 S663G probably benign Het
Trbv20 T G 6: 41,188,261 probably benign Het
Tspan9 T C 6: 128,034,172 I19M probably benign Het
Ttbk2 T A 2: 120,748,984 E552D probably benign Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACCACGTCCATGTGTAC -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- AGGACTGACTCCCCATTGATGTG -3'
(R):5'- TCTACAGACGACGGCAGC -3'
Posted On2015-05-15