Mutagenetix > Incidental Mutations

Incidental Mutation 'R4061:Tec'

315853

Institutional Source

Beutler Lab

Gene Symbol

Tec

Ensembl Gene

ENSMUSG00000029217

Gene Name

tec protein tyrosine kinase

Synonyms

MMRRC Submission

040852-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.182) question?

Stock #

R4061 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

72755716-72868483 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 72823409 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533] [ENSMUST00000202547]

Predicted Effect

probably benign
Transcript: ENSMUST00000071944

SMART Domains

Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
PH	5	113	2.13e-17	SMART
BTK	113	149	1.79e-21	SMART
low complexity region	158	177	N/A	INTRINSIC
SH3	181	237	7.06e-17	SMART
SH2	244	335	4.05e-28	SMART
TyrKc	369	618	2.13e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073843

SMART Domains

Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
PH	5	113	2.13e-17	SMART
BTK	113	149	1.79e-21	SMART
low complexity region	158	177	N/A	INTRINSIC
SH3	181	230	2.85e-3	SMART
SH2	222	313	9.96e-28	SMART
TyrKc	347	596	2.13e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113594

SMART Domains

Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
PH	5	113	2.13e-17	SMART
BTK	113	149	1.79e-21	SMART
low complexity region	158	177	N/A	INTRINSIC
SH3	181	237	7.06e-17	SMART
SH2	244	335	4.05e-28	SMART
TyrKc	369	618	2.13e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126481

SMART Domains

Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
PH	5	113	2.13e-17	SMART
BTK	113	149	1.79e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138842

SMART Domains

Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
Pfam:PH	5	98	1.6e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149533

SMART Domains

Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

Domain	Start	End	E-Value	Type
Pfam:PH	5	98	1.6e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150193

Predicted Effect

probably benign
Transcript: ENSMUST00000202547

Meta Mutation Damage Score

0.0664

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	A	T	1: 53,158,769	L140Q	probably damaging	Het
Adam25	A	G	8: 40,753,782	I28M	possibly damaging	Het
Anks1b	A	G	10: 90,307,622	S464G	probably damaging	Het
AU040320	T	A	4: 126,835,695	M550K	probably damaging	Het
Cab39l	A	G	14: 59,499,607	K59E	possibly damaging	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Csmd1	A	G	8: 15,945,158	S2626P	probably benign	Het
Ctss	C	T	3: 95,543,034	R99W	probably benign	Het
Deptor	A	T	15: 55,208,781	M219L	probably benign	Het
Disp1	A	G	1: 183,087,700	V1052A	probably damaging	Het
Esyt3	C	T	9: 99,320,838	S504N	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Folh1	T	A	7: 86,756,962	Y301F	possibly damaging	Het
Gm14443	G	A	2: 175,169,609	T348I	probably benign	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Iars2	A	T	1: 185,303,386	H552Q	possibly damaging	Het
Il18r1	G	A	1: 40,474,936	V101I	probably benign	Het
Impdh2	A	G	9: 108,562,804	R182G	possibly damaging	Het
Krt12	A	T	11: 99,416,015	M487K	unknown	Het
Lmln	C	A	16: 33,066,391	Y89*	probably null	Het
Lrrc38	T	A	4: 143,350,506	L113Q	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Muc5ac	A	G	7: 141,811,130	D1947G	possibly damaging	Het
Myh13	A	T	11: 67,330,889	I177F	possibly damaging	Het
Nfasc	T	C	1: 132,597,845	Y904C	probably damaging	Het
Obscn	G	A	11: 59,008,532	P1000S	probably damaging	Het
Olfr1086	T	A	2: 86,676,818	I172F	probably damaging	Het
Olfr658	T	A	7: 104,644,473	K298*	probably null	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Pclo	A	G	5: 14,540,566	E960G	unknown	Het
Plagl1	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC	10: 13,128,771		probably benign	Het
Prl7a1	T	C	13: 27,635,849	I141V	possibly damaging	Het
Ptpn18	A	T	1: 34,472,930	H45L	possibly damaging	Het
Sbno1	A	T	5: 124,388,572	M960K	probably damaging	Het
Slx4ip	T	A	2: 137,005,017	S67R	probably benign	Het
Spata18	A	G	5: 73,671,166	K243E	probably damaging	Het
Tcp1	A	G	17: 12,920,863	Q265R	probably benign	Het
Thbs4	A	G	13: 92,776,097		probably null	Het
Tln1	T	A	4: 43,549,177	Q635L	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Uap1	T	C	1: 170,158,846	E189G	possibly damaging	Het
Usp21	G	A	1: 171,285,401		probably benign	Het
Vmn1r118	G	T	7: 20,912,008	Q114K	probably damaging	Het
Vmn1r38	A	T	6: 66,776,848	C95S	possibly damaging	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Vmn2r84	T	A	10: 130,386,029	E774V	probably damaging	Het

Other mutations in Tec

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Tec	APN	5	72768768	missense	probably damaging	1.00
IGL00980:Tec	APN	5	72786798	missense	probably damaging	1.00
IGL01986:Tec	APN	5	72782005	nonsense	probably null
IGL02505:Tec	APN	5	72789244	missense	probably damaging	1.00
IGL02522:Tec	APN	5	72789172	missense	probably benign	0.01
IGL02527:Tec	APN	5	72779415	splice site	probably null
IGL03292:Tec	APN	5	72757364	missense	probably null	0.98
IGL02988:Tec	UTSW	5	72768747	missense	possibly damaging	0.95
R0254:Tec	UTSW	5	72763556	splice site	probably benign
R0254:Tec	UTSW	5	72783738	missense	probably benign	0.12
R0646:Tec	UTSW	5	72823497	missense	probably damaging	1.00
R1122:Tec	UTSW	5	72779449	missense	probably damaging	0.96
R1495:Tec	UTSW	5	72786755	missense	probably damaging	1.00
R1617:Tec	UTSW	5	72782105	missense	probably damaging	0.97
R3905:Tec	UTSW	5	72760362	missense	probably damaging	1.00
R3953:Tec	UTSW	5	72782177	critical splice acceptor site	probably null
R3954:Tec	UTSW	5	72782177	critical splice acceptor site	probably null
R3955:Tec	UTSW	5	72782177	critical splice acceptor site	probably null
R3981:Tec	UTSW	5	72823599	utr 5 prime	probably benign
R4389:Tec	UTSW	5	72782007	missense	probably benign
R4507:Tec	UTSW	5	72760358	missense	probably damaging	1.00
R4689:Tec	UTSW	5	72823637	start gained	probably benign
R4702:Tec	UTSW	5	72783731	missense	possibly damaging	0.71
R4776:Tec	UTSW	5	72768776	missense	probably benign	0.38
R4911:Tec	UTSW	5	72756351	missense	probably benign	0.05
R4923:Tec	UTSW	5	72782022	nonsense	probably null
R4932:Tec	UTSW	5	72760393	nonsense	probably null
R5595:Tec	UTSW	5	72768744	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TACAGGAATGGATTTTCTCTGGC -3'
(R):5'- ATCCGGAGATCGTCAATGGC -3'

Sequencing Primer
(F):5'- GCAGATTAATTCATTCGAGAGCTGCC -3'
(R):5'- GACCGAGATGAATTTCAACACTATC -3'

Posted On

2015-05-15