Incidental Mutation 'R4061:Otop2'
ID315874
Institutional Source Beutler Lab
Gene Symbol Otop2
Ensembl Gene ENSMUSG00000050201
Gene Nameotopetrin 2
Synonyms
MMRRC Submission 040852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4061 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115307163-115332303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115329375 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 347 (G347D)
Ref Sequence ENSEMBL: ENSMUSP00000102154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000106544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055490
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106544
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam25 A G 8: 40,753,782 I28M possibly damaging Het
Anks1b A G 10: 90,307,622 S464G probably damaging Het
AU040320 T A 4: 126,835,695 M550K probably damaging Het
Cab39l A G 14: 59,499,607 K59E possibly damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Csmd1 A G 8: 15,945,158 S2626P probably benign Het
Ctss C T 3: 95,543,034 R99W probably benign Het
Deptor A T 15: 55,208,781 M219L probably benign Het
Disp1 A G 1: 183,087,700 V1052A probably damaging Het
Esyt3 C T 9: 99,320,838 S504N probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Folh1 T A 7: 86,756,962 Y301F possibly damaging Het
Gm14443 G A 2: 175,169,609 T348I probably benign Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Iars2 A T 1: 185,303,386 H552Q possibly damaging Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Impdh2 A G 9: 108,562,804 R182G possibly damaging Het
Krt12 A T 11: 99,416,015 M487K unknown Het
Lmln C A 16: 33,066,391 Y89* probably null Het
Lrrc38 T A 4: 143,350,506 L113Q probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Muc5ac A G 7: 141,811,130 D1947G possibly damaging Het
Myh13 A T 11: 67,330,889 I177F possibly damaging Het
Nfasc T C 1: 132,597,845 Y904C probably damaging Het
Obscn G A 11: 59,008,532 P1000S probably damaging Het
Olfr1086 T A 2: 86,676,818 I172F probably damaging Het
Olfr658 T A 7: 104,644,473 K298* probably null Het
Pclo A G 5: 14,540,566 E960G unknown Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Prl7a1 T C 13: 27,635,849 I141V possibly damaging Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Sbno1 A T 5: 124,388,572 M960K probably damaging Het
Slx4ip T A 2: 137,005,017 S67R probably benign Het
Spata18 A G 5: 73,671,166 K243E probably damaging Het
Tcp1 A G 17: 12,920,863 Q265R probably benign Het
Tec C T 5: 72,823,409 probably benign Het
Thbs4 A G 13: 92,776,097 probably null Het
Tln1 T A 4: 43,549,177 Q635L probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Uap1 T C 1: 170,158,846 E189G possibly damaging Het
Usp21 G A 1: 171,285,401 probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Vmn1r38 A T 6: 66,776,848 C95S possibly damaging Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Vmn2r84 T A 10: 130,386,029 E774V probably damaging Het
Other mutations in Otop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Otop2 APN 11 115331909 missense probably damaging 1.00
IGL01832:Otop2 APN 11 115326943 missense probably benign
IGL02114:Otop2 APN 11 115326980 missense possibly damaging 0.64
IGL02432:Otop2 APN 11 115329162 missense probably damaging 0.99
IGL02453:Otop2 APN 11 115324629 nonsense probably null
IGL02986:Otop2 APN 11 115329567 missense probably benign 0.11
IGL03225:Otop2 APN 11 115329807 missense probably damaging 1.00
R0402:Otop2 UTSW 11 115326408 splice site probably benign
R0553:Otop2 UTSW 11 115329462 missense probably damaging 0.98
R1209:Otop2 UTSW 11 115324643 missense possibly damaging 0.70
R1497:Otop2 UTSW 11 115329849 unclassified probably null
R1765:Otop2 UTSW 11 115324678 missense probably benign 0.04
R1822:Otop2 UTSW 11 115324628 missense probably benign 0.41
R1926:Otop2 UTSW 11 115326955 missense probably benign 0.00
R2151:Otop2 UTSW 11 115329411 missense possibly damaging 0.90
R2192:Otop2 UTSW 11 115326931 missense possibly damaging 0.63
R2350:Otop2 UTSW 11 115326850 missense probably damaging 0.97
R2352:Otop2 UTSW 11 115329101 missense probably damaging 1.00
R2915:Otop2 UTSW 11 115329146 missense probably benign 0.07
R3614:Otop2 UTSW 11 115329146 missense probably benign 0.07
R4060:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4062:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4063:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4064:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4184:Otop2 UTSW 11 115329845 missense probably benign 0.05
R4844:Otop2 UTSW 11 115323375 splice site probably null
R5681:Otop2 UTSW 11 115326859 missense probably damaging 1.00
R5713:Otop2 UTSW 11 115329044 missense probably damaging 0.98
R6738:Otop2 UTSW 11 115329492 missense probably damaging 1.00
R6975:Otop2 UTSW 11 115329326 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAATGTGGGAAGGCTGCTC -3'
(R):5'- CTGAGCGATCATGAGTAGAGC -3'

Sequencing Primer
(F):5'- TCCAGGGTCAGCCTGTTC -3'
(R):5'- CGTGGGACAGGTTGAGC -3'
Posted On2015-05-15