Incidental Mutation 'R4062:Emilin3'
ID315893
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Nameelastin microfibril interfacer 3
SynonymsEmilin5, EMILIN-T
MMRRC Submission 040971-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4062 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160906437-160912328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160907796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 631 (T631A)
Ref Sequence ENSEMBL: ENSMUSP00000105080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
AA Change: T678A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700
AA Change: T678A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
AA Change: T631A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700
AA Change: T631A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A T 1: 53,158,769 L140Q probably damaging Het
Adam17 T C 12: 21,325,457 D787G probably damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bnip3l T C 14: 67,008,738 N16S possibly damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cdc40 A T 10: 40,849,852 probably null Het
Clec4b1 C A 6: 123,068,484 H55N probably benign Het
Cyp4a10 A T 4: 115,519,701 R87S probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Dytn A G 1: 63,647,447 C355R probably benign Het
Ep400 A T 5: 110,741,981 M472K probably benign Het
Erap1 G T 13: 74,663,536 M338I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fanca T C 8: 123,275,172 T1061A probably benign Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gcdh T C 8: 84,892,453 I152V probably damaging Het
Gls T C 1: 52,196,748 K403E probably damaging Het
Gorasp2 T C 2: 70,679,513 C173R probably damaging Het
Greb1l G A 18: 10,522,150 V749I probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Il18r1 G A 1: 40,474,936 V101I probably benign Het
Incenp A T 19: 9,883,778 M480K unknown Het
Isl1 T A 13: 116,303,090 I241F probably benign Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lcp1 T C 14: 75,215,180 V442A probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mbnl1 T C 3: 60,603,755 L136P probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nkd2 C T 13: 73,822,690 G258R probably null Het
Obscn T C 11: 59,082,710 T1932A probably damaging Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Plagl1 TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC TGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCC 10: 13,128,771 probably benign Het
Ptpn18 A T 1: 34,472,930 H45L possibly damaging Het
Rab3il1 T C 19: 10,026,624 S36P probably benign Het
Rims1 G T 1: 22,533,583 N512K probably benign Het
Rinl T C 7: 28,790,715 Y60H probably benign Het
Scamp2 G T 9: 57,577,262 probably null Het
Sept9 T C 11: 117,352,265 S324P probably damaging Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Soat2 A G 15: 102,161,091 T396A possibly damaging Het
Tenm2 C T 11: 36,008,655 G2559S probably damaging Het
Tpcn1 G A 5: 120,557,897 A97V possibly damaging Het
Trdn A G 10: 33,257,087 E311G probably benign Het
Usp13 T C 3: 32,881,423 Y333H probably damaging Het
Usp18 A G 6: 121,261,367 T158A probably benign Het
Vmn1r118 G T 7: 20,912,008 Q114K probably damaging Het
Wwp1 A T 4: 19,638,644 N566K possibly damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R1655:Emilin3 UTSW 2 160910866 critical splice acceptor site probably null
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R3624:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4365:Emilin3 UTSW 2 160908486 missense probably benign
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5227:Emilin3 UTSW 2 160909265 missense probably damaging 1.00
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
R7353:Emilin3 UTSW 2 160908821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGTCCAACAGGTCATC -3'
(R):5'- ATCCCTGGATGAACGAGAACG -3'

Sequencing Primer
(F):5'- TCCAACAGGTCATCCCGGAG -3'
(R):5'- AAGAGTGGAAGCCGAGGTCC -3'
Posted On2015-05-15