Incidental Mutation 'R4063:Adamtsl4'
ID315946
Institutional Source Beutler Lab
Gene Symbol Adamtsl4
Ensembl Gene ENSMUSG00000015850
Gene NameADAMTS-like 4
SynonymsTsrc1
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95676201-95687917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95677554 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 935 (K935E)
Ref Sequence ENSEMBL: ENSMUSP00000113424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015994] [ENSMUST00000117782]
Predicted Effect probably benign
Transcript: ENSMUST00000015994
AA Change: K935E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000015994
Gene: ENSMUSG00000015850
AA Change: K935E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3.9e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 995 1025 4.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117782
AA Change: K935E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113424
Gene: ENSMUSG00000015850
AA Change: K935E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSP1 46 96 1.07e-4 SMART
low complexity region 109 118 N/A INTRINSIC
low complexity region 160 172 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
Pfam:ADAM_spacer1 449 564 3e-31 PFAM
low complexity region 607 623 N/A INTRINSIC
TSP1 632 688 6e0 SMART
TSP1 690 748 5.64e-4 SMART
TSP1 750 806 7.16e-6 SMART
TSP1 808 871 1.95e-2 SMART
TSP1 875 933 7.86e-3 SMART
TSP1 935 988 3.34e-6 SMART
Pfam:PLAC 994 1026 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151054
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ADAMTS superfamily of secreted proteins, which contain a metalloprotease domain at the N-terminus and a C-terminal ancillary domain. ADAMTS-like proteins lack protease activity and resemble the ancillary domain of ADAMTS proteins. ADAMTS-like proteins have been implicated in regulation of the extracellular matrix. The encoded protein contains 7 thrombospondin type 1 repeats, a conserved extracellular domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Adamtsl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Adamtsl4 APN 3 95677533 missense probably benign 0.22
IGL01685:Adamtsl4 APN 3 95684595 missense possibly damaging 0.93
IGL01707:Adamtsl4 APN 3 95683991 missense probably benign 0.39
IGL02105:Adamtsl4 APN 3 95680064 missense probably damaging 1.00
IGL02545:Adamtsl4 APN 3 95683374 nonsense probably null
IGL03089:Adamtsl4 APN 3 95677246 missense probably damaging 1.00
R0099:Adamtsl4 UTSW 3 95684139 missense probably benign 0.00
R0718:Adamtsl4 UTSW 3 95679608 missense possibly damaging 0.49
R0962:Adamtsl4 UTSW 3 95684488 nonsense probably null
R1157:Adamtsl4 UTSW 3 95683661 missense possibly damaging 0.88
R1434:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R1486:Adamtsl4 UTSW 3 95681856 missense probably benign 0.23
R1579:Adamtsl4 UTSW 3 95685497 start gained probably benign
R1703:Adamtsl4 UTSW 3 95677614 missense probably damaging 1.00
R1757:Adamtsl4 UTSW 3 95677942 missense probably benign 0.00
R2018:Adamtsl4 UTSW 3 95681102 missense probably damaging 1.00
R2108:Adamtsl4 UTSW 3 95681047 missense probably damaging 1.00
R3889:Adamtsl4 UTSW 3 95680857 missense probably damaging 1.00
R4062:Adamtsl4 UTSW 3 95677554 missense probably benign 0.00
R4124:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4128:Adamtsl4 UTSW 3 95681672 missense probably benign 0.21
R4432:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4433:Adamtsl4 UTSW 3 95681759 unclassified probably null
R4643:Adamtsl4 UTSW 3 95684619 missense possibly damaging 0.90
R4694:Adamtsl4 UTSW 3 95679745 missense probably damaging 1.00
R4719:Adamtsl4 UTSW 3 95679586 critical splice donor site probably null
R4929:Adamtsl4 UTSW 3 95678005 missense probably damaging 1.00
R5044:Adamtsl4 UTSW 3 95681650 critical splice donor site probably null
R5212:Adamtsl4 UTSW 3 95677670 missense probably damaging 1.00
R5234:Adamtsl4 UTSW 3 95680920 missense probably benign 0.00
R5268:Adamtsl4 UTSW 3 95680163 missense probably damaging 0.98
R5473:Adamtsl4 UTSW 3 95679993 missense probably damaging 0.98
R5509:Adamtsl4 UTSW 3 95681357 missense probably benign 0.00
R5566:Adamtsl4 UTSW 3 95685455 critical splice donor site probably null
R5891:Adamtsl4 UTSW 3 95682313 missense possibly damaging 0.95
R5906:Adamtsl4 UTSW 3 95680784 missense probably damaging 1.00
R6224:Adamtsl4 UTSW 3 95681729 missense probably damaging 1.00
R6530:Adamtsl4 UTSW 3 95681054 missense probably benign 0.00
R6861:Adamtsl4 UTSW 3 95680884 missense probably damaging 1.00
X0028:Adamtsl4 UTSW 3 95676964 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAACGTTCTCAGGGCTGCTC -3'
(R):5'- GCCCCACATTTTAAACTTAAGAGTG -3'

Sequencing Primer
(F):5'- CTGTGGTAGAACATTCTCCAGGAAC -3'
(R):5'- AGAGTGATCTCTCTTCCCCTC -3'
Posted On2015-05-15