Incidental Mutation 'R4063:Ppp1r13l'
ID315962
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R4063 (G1)
Quality Score223
Status Validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19370053 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 153 (H153L)
Ref Sequence ENSEMBL: ENSMUSP00000047839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621] [ENSMUST00000127785] [ENSMUST00000132655] [ENSMUST00000140836]
Predicted Effect probably benign
Transcript: ENSMUST00000047621
AA Change: H153L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734
AA Change: H153L

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127785
SMART Domains Protein: ENSMUSP00000116351
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132655
SMART Domains Protein: ENSMUSP00000118309
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140836
SMART Domains Protein: ENSMUSP00000114443
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R0507:Ppp1r13l UTSW 7 19375814 missense possibly damaging 0.63
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4685:Ppp1r13l UTSW 7 19375383 critical splice donor site probably null
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6171:Ppp1r13l UTSW 7 19377511 missense probably benign 0.06
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATAGAGGCCCGTTTTGGAC -3'
(R):5'- GTCATCTGGTGAAAGGGGTC -3'

Sequencing Primer
(F):5'- CGTTTTGGACGCTCGGAG -3'
(R):5'- AGCCTCCCAAAGAGAGGGTC -3'
Posted On2015-05-15