Incidental Mutation 'R4063:Prss50'
ID315969
Institutional Source Beutler Lab
Gene Symbol Prss50
Ensembl Gene ENSMUSG00000048752
Gene Nameprotease, serine 50
SynonymsTsp50
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110857967-110864629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110858412 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 141 (D141G)
Ref Sequence ENSEMBL: ENSMUSP00000059668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051097] [ENSMUST00000119427] [ENSMUST00000176403]
Predicted Effect probably benign
Transcript: ENSMUST00000051097
AA Change: D141G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059668
Gene: ENSMUSG00000048752
AA Change: D141G

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
low complexity region 112 127 N/A INTRINSIC
Tryp_SPc 172 407 2.87e-43 SMART
low complexity region 425 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119427
SMART Domains Protein: ENSMUSP00000112855
Gene: ENSMUSG00000049719

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 40 273 1.62e-60 SMART
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176403
SMART Domains Protein: ENSMUSP00000135787
Gene: ENSMUSG00000049719

DomainStartEndE-ValueType
Tryp_SPc 43 276 1.62e-60 SMART
transmembrane domain 291 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196027
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Prss50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Prss50 APN 9 110862406 missense possibly damaging 0.89
IGL01838:Prss50 APN 9 110864492 missense probably benign 0.38
IGL03185:Prss50 APN 9 110858211 missense probably benign
R0347:Prss50 UTSW 9 110862350 missense probably damaging 0.97
R1545:Prss50 UTSW 9 110861268 missense probably damaging 0.99
R1660:Prss50 UTSW 9 110862489 missense possibly damaging 0.61
R1844:Prss50 UTSW 9 110858013 unclassified probably benign
R1969:Prss50 UTSW 9 110862381 missense probably damaging 0.97
R2025:Prss50 UTSW 9 110861260 missense probably benign 0.00
R2090:Prss50 UTSW 9 110862293 missense probably damaging 1.00
R2917:Prss50 UTSW 9 110862545 missense probably null 1.00
R4799:Prss50 UTSW 9 110863796 missense probably damaging 0.99
R5763:Prss50 UTSW 9 110862449 nonsense probably null
R5984:Prss50 UTSW 9 110862386 missense probably damaging 0.97
R6159:Prss50 UTSW 9 110864303 missense probably benign 0.32
R6318:Prss50 UTSW 9 110861299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTGGAGGAACCTAGCG -3'
(R):5'- CACTTGTACAGGGACGTTCC -3'

Sequencing Primer
(F):5'- TGACTCGCTGGAGACCTTC -3'
(R):5'- GGACGTTCCCTTCTGCTTTTC -3'
Posted On2015-05-15