Incidental Mutation 'R4063:Il22ra2'
ID315971
Institutional Source Beutler Lab
Gene Symbol Il22ra2
Ensembl Gene ENSMUSG00000039760
Gene Nameinterleukin 22 receptor, alpha 2
SynonymsIl-22bp
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19621998-19634681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19626652 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 73 (D73V)
Ref Sequence ENSEMBL: ENSMUSP00000042642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036564
AA Change: D73V

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042642
Gene: ENSMUSG00000039760
AA Change: D73V

DomainStartEndE-ValueType
Pfam:Tissue_fac 6 113 3.4e-37 PFAM
Pfam:Interfer-bind 125 230 1.4e-26 PFAM
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display accelerated tumor formation in a colitis associated colon cancer model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Il22ra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Il22ra2 APN 10 19626744 missense probably benign 0.04
IGL02835:Il22ra2 UTSW 10 19626676 missense probably benign 0.04
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R0009:Il22ra2 UTSW 10 19624458 missense probably damaging 1.00
R1687:Il22ra2 UTSW 10 19632872 missense probably benign 0.09
R1802:Il22ra2 UTSW 10 19626699 missense probably damaging 0.98
R2138:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R2139:Il22ra2 UTSW 10 19632870 missense probably benign 0.00
R3936:Il22ra2 UTSW 10 19631708 missense probably benign 0.00
R4559:Il22ra2 UTSW 10 19626712 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTAACAGCGTGGTTAGCGTG -3'
(R):5'- CCTGAGGATAGCGTCAAGTAAG -3'

Sequencing Primer
(F):5'- CGTGGTTAGCGTGAAGGAAC -3'
(R):5'- CGACCATCCAGAGTTTGTTCAAAGG -3'
Posted On2015-05-15