Incidental Mutation 'R4063:Espl1'
ID315984
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102312989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 944 (I944V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTTGGAATGTTAG -3'
(R):5'- AGACAGACATCAATGTGGAGCC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- TGGAGCCACAGTCGGATTCAC -3'
Posted On2015-05-15