Incidental Mutation 'R4063:Olfr205'
ID315985
Institutional Source Beutler Lab
Gene Symbol Olfr205
Ensembl Gene ENSMUSG00000094422
Gene Nameolfactory receptor 205
SynonymsMOR182-11P, GA_x54KRFPKG5P-55543875-55542958
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59328005-59331138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59328880 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 210 (S210A)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
Predicted Effect probably benign
Transcript: ENSMUST00000074125
AA Change: S210A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: S210A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213910
AA Change: S210A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Txndc2 A G 17: 65,638,084 I366T possibly damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Olfr205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Olfr205 APN 16 59328725 missense probably benign 0.21
IGL03236:Olfr205 APN 16 59328837 missense probably damaging 0.97
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0167:Olfr205 UTSW 16 59328974 nonsense probably null
R0178:Olfr205 UTSW 16 59329420 missense probably damaging 1.00
R0371:Olfr205 UTSW 16 59329222 missense possibly damaging 0.60
R0577:Olfr205 UTSW 16 59328698 missense probably benign 0.01
R0597:Olfr205 UTSW 16 59328760 missense probably damaging 1.00
R0967:Olfr205 UTSW 16 59329183 missense possibly damaging 0.66
R1670:Olfr205 UTSW 16 59329244 missense probably benign 0.03
R1702:Olfr205 UTSW 16 59329141 missense probably benign 0.12
R1995:Olfr205 UTSW 16 59329291 missense probably damaging 1.00
R2239:Olfr205 UTSW 16 59329375 missense probably damaging 0.99
R4400:Olfr205 UTSW 16 59328598 missense probably benign
R4666:Olfr205 UTSW 16 59329210 missense possibly damaging 0.91
R4795:Olfr205 UTSW 16 59328850 missense probably benign 0.09
R5327:Olfr205 UTSW 16 59329098 missense probably benign 0.01
R5471:Olfr205 UTSW 16 59328631 missense probably damaging 1.00
R5770:Olfr205 UTSW 16 59329151 nonsense probably null
R6195:Olfr205 UTSW 16 59329422 missense possibly damaging 0.81
R6702:Olfr205 UTSW 16 59328598 missense probably benign
X0026:Olfr205 UTSW 16 59329350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGGTTTTCACCTGGTGCAG -3'
(R):5'- CCAAGAGACTCTGCACTGTGTTC -3'

Sequencing Primer
(F):5'- TGGTGCAGACCCATGACTCAC -3'
(R):5'- AGAGACTCTGCACTGTGTTCATCAG -3'
Posted On2015-05-15