Mutagenetix > Incidental Mutations

Incidental Mutation 'R4063:Mdga1'

315987

Institutional Source

Beutler Lab

Gene Symbol

Mdga1

Ensembl Gene

ENSMUSG00000043557

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 1

Synonyms

MMRRC Submission

041619-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.513) question?

Stock #

R4063 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29827956-29970087 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29838031 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 826 (C826R)

Ref Sequence

ENSEMBL: ENSMUSP00000073246 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000167190] [ENSMUST00000168044] [ENSMUST00000171691]

Predicted Effect

probably damaging
Transcript: ENSMUST00000073556
AA Change: C826R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: C826R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	741	911	1.02e-52	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165528

Predicted Effect

probably benign
Transcript: ENSMUST00000167190

SMART Domains

Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557

Domain	Start	End	E-Value	Type
low complexity region	236	246	N/A	INTRINSIC
low complexity region	251	265	N/A	INTRINSIC
IGc2	325	389	1.62e-12	SMART
IG	416	510	3.2e-2	SMART
IGc2	527	589	6.25e-14	SMART
IGc2	622	696	3.54e-4	SMART
IGc2	728	795	6.55e-8	SMART
IGc2	825	897	9.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000168044
AA Change: C127R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126571
Gene: ENSMUSG00000043557
AA Change: C127R

Domain	Start	End	E-Value	Type
Pfam:MAM	47	186	3.1e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170786

Predicted Effect

probably damaging
Transcript: ENSMUST00000171691
AA Change: C834R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: C834R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	51	115	1.62e-12	SMART
IG	142	236	3.2e-2	SMART
IGc2	253	315	6.25e-14	SMART
IGc2	348	422	3.54e-4	SMART
IGc2	454	521	6.55e-8	SMART
IGc2	551	623	9.49e-5	SMART
FN3	642	731	2.05e0	SMART
MAM	749	919	3.61e-53	SMART

Meta Mutation Damage Score

0.496

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	A	T	6: 146,953,108	F145L	probably benign	Het
3632451O06Rik	T	A	14: 49,773,987	M88L	probably benign	Het
Abcc9	T	C	6: 142,605,919	D1221G	possibly damaging	Het
Adamtsl4	T	C	3: 95,677,554	K935E	probably benign	Het
Ago4	A	T	4: 126,515,862		probably benign	Het
Arhgef28	T	C	13: 97,994,067	D421G	probably benign	Het
Atl2	T	C	17: 79,850,159	*413W	probably null	Het
B4galt7	C	A	13: 55,608,339		probably null	Het
C87977	T	C	4: 144,208,695	K161E	possibly damaging	Het
C8g	A	T	2: 25,499,413	S147T	probably damaging	Het
Clstn3	A	T	6: 124,449,833	Y510N	possibly damaging	Het
Cnot2	A	G	10: 116,537,396	V34A	possibly damaging	Het
Cyb5d2	A	T	11: 72,795,780		probably benign	Het
Dnah5	T	C	15: 28,420,998	I3827T	probably damaging	Het
Dnah7a	G	T	1: 53,425,217	Q3672K	probably benign	Het
Dock1	A	T	7: 135,115,292	Y1219F	possibly damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fat1	A	T	8: 45,025,481	E2521D	probably benign	Het
Gm10719	G	T	9: 3,019,043	W96L	probably damaging	Het
Gm13083	A	G	4: 143,615,989	D222G	possibly damaging	Het
H2-M2	G	A	17: 37,481,508	H291Y	probably damaging	Het
Hmgcl	T	C	4: 135,958,724	Y167H	probably damaging	Het
Il22ra2	A	T	10: 19,626,652	D73V	possibly damaging	Het
Incenp	A	T	19: 9,883,778	M480K	unknown	Het
Kdm6a	A	G	X: 18,250,875	T266A	probably benign	Het
Lipf	A	G	19: 33,965,565	N91S	probably benign	Het
M1ap	A	T	6: 83,003,775	N214I	probably damaging	Het
Mast3	A	G	8: 70,781,194	V969A	probably damaging	Het
Mrvi1	G	T	7: 110,923,777	A359D	probably benign	Het
Msx1	C	A	5: 37,824,021	A105S	probably benign	Het
Olfr205	A	C	16: 59,328,880	S210A	probably benign	Het
Otogl	A	T	10: 107,790,649	D1451E	probably benign	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Ppp1r13l	A	T	7: 19,370,053	H153L	probably benign	Het
Proz	A	G	8: 13,064,621	Y85C	probably damaging	Het
Prss50	A	G	9: 110,858,412	D141G	probably benign	Het
Rad54l2	T	A	9: 106,720,414	Q131L	probably benign	Het
Sdha	A	G	13: 74,323,958		probably benign	Het
Sema3d	T	A	5: 12,585,124	I719N	probably benign	Het
Slc18b1	A	T	10: 23,805,981	I148L	probably benign	Het
Tacc2	G	T	7: 130,729,122	D2086Y	probably damaging	Het
Tchh	T	C	3: 93,446,991	L1246P	unknown	Het
Tmprss11d	T	C	5: 86,309,318	I161V	probably benign	Het
Trpc3	T	C	3: 36,671,023	D268G	probably damaging	Het
Trpm8	G	A	1: 88,362,005	R895H	probably damaging	Het
Txndc2	A	G	17: 65,638,084	I366T	possibly damaging	Het
Ugt2a3	T	C	5: 87,336,866	I100V	probably benign	Het
Uhrf1bp1l	A	G	10: 89,816,055	N247S	probably benign	Het
Upp1	C	A	11: 9,131,709	P82Q	probably damaging	Het
Vim	A	G	2: 13,580,016		probably null	Het
Vmn2r12	A	T	5: 109,092,192	N168K	possibly damaging	Het
Zdhhc14	G	T	17: 5,752,708	C362F	probably damaging	Het
Zfp292	A	G	4: 34,810,863	V727A	probably damaging	Het
Zswim5	G	A	4: 116,877,980	G174D	unknown	Het

Other mutations in Mdga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01576:Mdga1	APN	17	29843127	missense	possibly damaging	0.50
IGL01637:Mdga1	APN	17	29839871	missense	probably damaging	1.00
IGL02130:Mdga1	APN	17	29857669	missense	possibly damaging	0.96
IGL02596:Mdga1	APN	17	29832405	splice site	probably benign
IGL03258:Mdga1	APN	17	29839913	missense	probably damaging	1.00
R0184:Mdga1	UTSW	17	29852442	missense	probably damaging	1.00
R0366:Mdga1	UTSW	17	29857708	missense	possibly damaging	0.85
R1017:Mdga1	UTSW	17	29850548	missense	probably damaging	0.98
R1520:Mdga1	UTSW	17	29846519	missense	probably benign	0.12
R1545:Mdga1	UTSW	17	29842902	missense	probably damaging	1.00
R1549:Mdga1	UTSW	17	29837998	missense	probably damaging	1.00
R1671:Mdga1	UTSW	17	29850629	missense	probably damaging	1.00
R1875:Mdga1	UTSW	17	29852607	missense	probably damaging	1.00
R1893:Mdga1	UTSW	17	29849226	missense	probably damaging	1.00
R1958:Mdga1	UTSW	17	29840888	missense	probably damaging	1.00
R1983:Mdga1	UTSW	17	29850605	missense	probably damaging	1.00
R2014:Mdga1	UTSW	17	29849313	missense	probably damaging	1.00
R2894:Mdga1	UTSW	17	29852504	missense	probably damaging	1.00
R2964:Mdga1	UTSW	17	29852468	missense	probably damaging	1.00
R3813:Mdga1	UTSW	17	29838479	missense	probably damaging	1.00
R3938:Mdga1	UTSW	17	29857622	missense	probably damaging	1.00
R3982:Mdga1	UTSW	17	29931264	missense	unknown
R4157:Mdga1	UTSW	17	29833343	missense	probably benign	0.32
R4183:Mdga1	UTSW	17	29969990	missense	unknown
R4392:Mdga1	UTSW	17	29850656	missense	probably damaging	1.00
R4393:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4396:Mdga1	UTSW	17	29850517	missense	probably damaging	1.00
R4806:Mdga1	UTSW	17	29842154	missense	probably benign	0.20
R4829:Mdga1	UTSW	17	29846369	missense	possibly damaging	0.91
R4923:Mdga1	UTSW	17	29838078	missense	probably damaging	0.99
R4932:Mdga1	UTSW	17	29857606	missense	probably damaging	1.00
R5015:Mdga1	UTSW	17	29839873	missense	possibly damaging	0.71
R5076:Mdga1	UTSW	17	29850554	missense	possibly damaging	0.93
R5141:Mdga1	UTSW	17	29852493	missense	probably benign	0.43
R5180:Mdga1	UTSW	17	29857736	splice site	probably benign
R5590:Mdga1	UTSW	17	29839867	missense	probably damaging	1.00
R5747:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R5748:Mdga1	UTSW	17	29850551	missense	probably benign	0.11
R6207:Mdga1	UTSW	17	29838517	missense	probably damaging	1.00
R6826:Mdga1	UTSW	17	29970026	missense	unknown
R6831:Mdga1	UTSW	17	29887516	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTATGTGGACCCCAGTTCCTG -3'
(R):5'- GCTAAGCTAGGTCTGAAGGG -3'

Sequencing Primer
(F):5'- AGTTCCTGGCAAGTTGTCTACAC -3'
(R):5'- TCTGAAGGGAGGAAATGAGCTGTG -3'

Posted On

2015-05-15