Incidental Mutation 'R4063:Txndc2'
ID315990
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Namethioredoxin domain containing 2 (spermatozoa)
SynonymsSptrx-1
MMRRC Submission 041619-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R4063 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location65637505-65642204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65638084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 366 (I366T)
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050236
AA Change: I366T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612
AA Change: I366T

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik A T 6: 146,953,108 F145L probably benign Het
3632451O06Rik T A 14: 49,773,987 M88L probably benign Het
Abcc9 T C 6: 142,605,919 D1221G possibly damaging Het
Adamtsl4 T C 3: 95,677,554 K935E probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Arhgef28 T C 13: 97,994,067 D421G probably benign Het
Atl2 T C 17: 79,850,159 *413W probably null Het
B4galt7 C A 13: 55,608,339 probably null Het
C87977 T C 4: 144,208,695 K161E possibly damaging Het
C8g A T 2: 25,499,413 S147T probably damaging Het
Clstn3 A T 6: 124,449,833 Y510N possibly damaging Het
Cnot2 A G 10: 116,537,396 V34A possibly damaging Het
Cyb5d2 A T 11: 72,795,780 probably benign Het
Dnah5 T C 15: 28,420,998 I3827T probably damaging Het
Dnah7a G T 1: 53,425,217 Q3672K probably benign Het
Dock1 A T 7: 135,115,292 Y1219F possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 A T 8: 45,025,481 E2521D probably benign Het
Gm10719 G T 9: 3,019,043 W96L probably damaging Het
Gm13083 A G 4: 143,615,989 D222G possibly damaging Het
H2-M2 G A 17: 37,481,508 H291Y probably damaging Het
Hmgcl T C 4: 135,958,724 Y167H probably damaging Het
Il22ra2 A T 10: 19,626,652 D73V possibly damaging Het
Incenp A T 19: 9,883,778 M480K unknown Het
Kdm6a A G X: 18,250,875 T266A probably benign Het
Lipf A G 19: 33,965,565 N91S probably benign Het
M1ap A T 6: 83,003,775 N214I probably damaging Het
Mast3 A G 8: 70,781,194 V969A probably damaging Het
Mdga1 A G 17: 29,838,031 C826R probably damaging Het
Mrvi1 G T 7: 110,923,777 A359D probably benign Het
Msx1 C A 5: 37,824,021 A105S probably benign Het
Olfr205 A C 16: 59,328,880 S210A probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Ppp1r13l A T 7: 19,370,053 H153L probably benign Het
Proz A G 8: 13,064,621 Y85C probably damaging Het
Prss50 A G 9: 110,858,412 D141G probably benign Het
Rad54l2 T A 9: 106,720,414 Q131L probably benign Het
Sdha A G 13: 74,323,958 probably benign Het
Sema3d T A 5: 12,585,124 I719N probably benign Het
Slc18b1 A T 10: 23,805,981 I148L probably benign Het
Tacc2 G T 7: 130,729,122 D2086Y probably damaging Het
Tchh T C 3: 93,446,991 L1246P unknown Het
Tmprss11d T C 5: 86,309,318 I161V probably benign Het
Trpc3 T C 3: 36,671,023 D268G probably damaging Het
Trpm8 G A 1: 88,362,005 R895H probably damaging Het
Ugt2a3 T C 5: 87,336,866 I100V probably benign Het
Uhrf1bp1l A G 10: 89,816,055 N247S probably benign Het
Upp1 C A 11: 9,131,709 P82Q probably damaging Het
Vim A G 2: 13,580,016 probably null Het
Vmn2r12 A T 5: 109,092,192 N168K possibly damaging Het
Zdhhc14 G T 17: 5,752,708 C362F probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zswim5 G A 4: 116,877,980 G174D unknown Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65638574 missense probably benign 0.41
IGL00985:Txndc2 APN 17 65638549 missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65638453 missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65638913 missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65637976 missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65639590 missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65639606 missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65637953 missense probably benign 0.01
R0737:Txndc2 UTSW 17 65639553 critical splice donor site probably null
R1525:Txndc2 UTSW 17 65638315 missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65638926 missense probably benign 0.44
R1746:Txndc2 UTSW 17 65638135 missense probably damaging 1.00
R4971:Txndc2 UTSW 17 65638854 missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65638060 missense probably benign 0.01
R6177:Txndc2 UTSW 17 65638471 missense probably benign 0.44
R6762:Txndc2 UTSW 17 65638972 missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65638291 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAAGGCCTAAGAGTTTGC -3'
(R):5'- AGACAGCGTCCAATCCAAGG -3'

Sequencing Primer
(F):5'- GAGAGCTGCACATCTTCTTCTG -3'
(R):5'- TCCAATCCAAGGAAGGTGAAGTCC -3'
Posted On2015-05-15