Incidental Mutation 'R4064:Slc26a9'
ID315997
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131763187 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 568 (Y568H)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]
Predicted Effect probably benign
Transcript: ENSMUST00000049027
AA Change: Y568H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: Y568H

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTACTTTGCCAACTCAGAGATC -3'
(R):5'- AAGTGCTCCCAGAGACTTCC -3'

Sequencing Primer
(F):5'- TTGCCAACTCAGAGATCTTCAGG -3'
(R):5'- AGAGACTTCCTGCCTCCC -3'
Posted On2015-05-15