Incidental Mutation 'R4064:Psmb7'
ID315998
Institutional Source Beutler Lab
Gene Symbol Psmb7
Ensembl Gene ENSMUSG00000026750
Gene Nameproteasome (prosome, macropain) subunit, beta type 7
SynonymsMC14
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location38588036-38644087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38640176 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000028083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028083]
PDB Structure
Mouse constitutive 20S proteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse constitutive 20S proteasome [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028083
AA Change: T98A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028083
Gene: ENSMUSG00000026750
AA Change: T98A

DomainStartEndE-ValueType
Pfam:Proteasome 40 221 5.4e-52 PFAM
Pfam:Pr_beta_C 235 271 2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175060
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Expression of this catalytic subunit is downregulated by gamma interferon, and proteolytic processing is required to generate a mature subunit. A pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Psmb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0029:Psmb7 UTSW 2 38633907 missense probably damaging 0.96
R0102:Psmb7 UTSW 2 38643365 missense possibly damaging 0.80
R0102:Psmb7 UTSW 2 38643365 missense possibly damaging 0.80
R3822:Psmb7 UTSW 2 38613428 splice site probably benign
R4108:Psmb7 UTSW 2 38642199 missense probably damaging 0.99
R4787:Psmb7 UTSW 2 38588271 missense probably benign 0.00
R5731:Psmb7 UTSW 2 38588277 missense probably damaging 1.00
R6160:Psmb7 UTSW 2 38643381 missense probably damaging 1.00
R6266:Psmb7 UTSW 2 38640187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGCAAATCATCCCCATG -3'
(R):5'- TACGGTTAAGGCTGGTTAGAC -3'

Sequencing Primer
(F):5'- CCTAGTTTCCAGGCATCTTCATG -3'
(R):5'- GGCTGGTTAGACAGAAATTTCATTGC -3'
Posted On2015-05-15