Incidental Mutation 'R4064:Zscan22'
ID316011
Institutional Source Beutler Lab
Gene Symbol Zscan22
Ensembl Gene ENSMUSG00000054715
Gene Namezinc finger and SCAN domain containing 22
SynonymsD530006B18Rik, Hkr2
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12897815-12909083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12907014 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 395 (T395I)
Ref Sequence ENSEMBL: ENSMUSP00000113314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055528] [ENSMUST00000117189] [ENSMUST00000119989] [ENSMUST00000120809]
Predicted Effect probably damaging
Transcript: ENSMUST00000055528
AA Change: T395I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057651
Gene: ENSMUSG00000054715
AA Change: T395I

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
SCAN 45 154 8.03e-50 SMART
ZnF_C2H2 273 292 6.64e1 SMART
ZnF_C2H2 298 320 6.88e-4 SMART
ZnF_C2H2 326 348 1.04e-3 SMART
ZnF_C2H2 354 376 8.02e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.06e-4 SMART
ZnF_C2H2 438 460 3.21e-4 SMART
ZnF_C2H2 466 488 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117189
AA Change: T236I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112684
Gene: ENSMUSG00000054715
AA Change: T236I

DomainStartEndE-ValueType
ZnF_C2H2 114 133 6.64e1 SMART
ZnF_C2H2 139 161 6.88e-4 SMART
ZnF_C2H2 167 189 1.04e-3 SMART
ZnF_C2H2 195 217 8.02e-5 SMART
ZnF_C2H2 223 245 6.42e-4 SMART
ZnF_C2H2 251 273 1.06e-4 SMART
ZnF_C2H2 279 301 3.21e-4 SMART
ZnF_C2H2 307 329 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119989
AA Change: T236I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113486
Gene: ENSMUSG00000054715
AA Change: T236I

DomainStartEndE-ValueType
ZnF_C2H2 114 133 6.64e1 SMART
ZnF_C2H2 139 161 6.88e-4 SMART
ZnF_C2H2 167 189 1.04e-3 SMART
ZnF_C2H2 195 217 8.02e-5 SMART
ZnF_C2H2 223 245 6.42e-4 SMART
ZnF_C2H2 251 273 1.06e-4 SMART
ZnF_C2H2 279 301 3.21e-4 SMART
ZnF_C2H2 307 329 1.72e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120809
AA Change: T395I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113314
Gene: ENSMUSG00000054715
AA Change: T395I

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
SCAN 45 154 8.03e-50 SMART
ZnF_C2H2 273 292 6.64e1 SMART
ZnF_C2H2 298 320 6.88e-4 SMART
ZnF_C2H2 326 348 1.04e-3 SMART
ZnF_C2H2 354 376 8.02e-5 SMART
ZnF_C2H2 382 404 6.42e-4 SMART
ZnF_C2H2 410 432 1.06e-4 SMART
ZnF_C2H2 438 460 3.21e-4 SMART
ZnF_C2H2 466 488 1.72e-4 SMART
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Other mutations in Zscan22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Zscan22 APN 7 12906471 missense probably benign 0.01
IGL02408:Zscan22 APN 7 12906499 missense probably benign 0.09
PIT4378001:Zscan22 UTSW 7 12904056 missense possibly damaging 0.89
R0079:Zscan22 UTSW 7 12904087 critical splice donor site probably null
R1677:Zscan22 UTSW 7 12906803 missense probably damaging 1.00
R1731:Zscan22 UTSW 7 12906980 missense probably damaging 1.00
R1944:Zscan22 UTSW 7 12903840 missense probably damaging 0.98
R2258:Zscan22 UTSW 7 12903960 missense probably damaging 1.00
R2276:Zscan22 UTSW 7 12906823 nonsense probably null
R3115:Zscan22 UTSW 7 12907290 missense probably benign 0.39
R4274:Zscan22 UTSW 7 12906324 missense probably benign 0.01
R4691:Zscan22 UTSW 7 12906561 missense probably benign 0.06
R5355:Zscan22 UTSW 7 12906508 missense probably benign 0.00
R5607:Zscan22 UTSW 7 12906992 missense probably damaging 1.00
R5608:Zscan22 UTSW 7 12906992 missense probably damaging 1.00
R5789:Zscan22 UTSW 7 12903926 missense probably benign
R6293:Zscan22 UTSW 7 12906907 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCACACAGGAGCAAAGCC -3'
(R):5'- TCAATGAGGGAGGAGCTTTG -3'

Sequencing Primer
(F):5'- AAAGCCTTCAGTCGCGTTG -3'
(R):5'- GCTTTGTGCGAAGGCCTTC -3'
Posted On2015-05-15