Incidental Mutation 'R4064:Gtpbp2'
ID316034
Institutional Source Beutler Lab
Gene Symbol Gtpbp2
Ensembl Gene ENSMUSG00000023952
Gene NameGTP binding protein 2
Synonyms
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46161032-46169370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46167327 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 467 (R467H)
Ref Sequence ENSEMBL: ENSMUSP00000024748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000024749] [ENSMUST00000166563] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably damaging
Transcript: ENSMUST00000024748
AA Change: R467H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952
AA Change: R467H

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024749
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164338
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect probably benign
Transcript: ENSMUST00000166563
SMART Domains Protein: ENSMUSP00000127896
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect unknown
Transcript: ENSMUST00000166701
AA Change: R32H
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952
AA Change: R32H

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171901
Predicted Effect probably damaging
Transcript: ENSMUST00000172170
AA Change: R467H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952
AA Change: R467H

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Gtpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Gtpbp2 APN 17 46168254 missense probably damaging 1.00
IGL01534:Gtpbp2 APN 17 46163504 missense probably damaging 1.00
IGL02272:Gtpbp2 APN 17 46164781 missense probably benign 0.00
IGL02864:Gtpbp2 APN 17 46165594 missense probably benign 0.00
R0894:Gtpbp2 UTSW 17 46165969 missense possibly damaging 0.85
R1575:Gtpbp2 UTSW 17 46165943 missense probably damaging 1.00
R1632:Gtpbp2 UTSW 17 46168592 missense probably benign
R1639:Gtpbp2 UTSW 17 46165771 splice site probably null
R1786:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2132:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2133:Gtpbp2 UTSW 17 46161202 missense probably benign 0.01
R2223:Gtpbp2 UTSW 17 46167227 missense probably benign
R3742:Gtpbp2 UTSW 17 46165882 missense probably benign 0.03
R4060:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4061:Gtpbp2 UTSW 17 46167327 missense probably damaging 1.00
R4387:Gtpbp2 UTSW 17 46166358 missense probably benign 0.03
R4469:Gtpbp2 UTSW 17 46161313 missense probably damaging 0.99
R4583:Gtpbp2 UTSW 17 46161145 missense probably damaging 0.99
R4664:Gtpbp2 UTSW 17 46161154 missense probably benign 0.33
R4724:Gtpbp2 UTSW 17 46167221 critical splice acceptor site probably null
R5338:Gtpbp2 UTSW 17 46167834 missense probably damaging 1.00
R5368:Gtpbp2 UTSW 17 46166304 splice site probably benign
R5832:Gtpbp2 UTSW 17 46167862 missense probably damaging 0.98
R6490:Gtpbp2 UTSW 17 46168221 missense probably benign 0.01
R6526:Gtpbp2 UTSW 17 46164111 intron probably null
R6723:Gtpbp2 UTSW 17 46168276 missense probably benign 0.05
R6860:Gtpbp2 UTSW 17 46167988 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGACCTTGGCAAAGAAGTCAG -3'
(R):5'- AGCATCCTACGCTCTTTCAGTAG -3'

Sequencing Primer
(F):5'- TCAGAGGGAGCTATGCTGACAC -3'
(R):5'- TCAGTAGTCTATATAGCCAGGCC -3'
Posted On2015-05-15