Incidental Mutation 'R4065:Cant1'
ID316075
Institutional Source Beutler Lab
Gene Symbol Cant1
Ensembl Gene ENSMUSG00000025575
Gene Namecalcium activated nucleotidase 1
Synonyms5830420C20Rik, D11Bwg0554e, SCAN-1, Apy1h, Shapy
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4065 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118406289-118419086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118407997 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 313 (D313E)
Ref Sequence ENSEMBL: ENSMUSP00000126919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017620] [ENSMUST00000092378] [ENSMUST00000106287] [ENSMUST00000106288] [ENSMUST00000106289] [ENSMUST00000164927]
Predicted Effect probably benign
Transcript: ENSMUST00000017620
AA Change: D313E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017620
Gene: ENSMUSG00000025575
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092378
AA Change: D313E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090032
Gene: ENSMUSG00000025575
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106287
AA Change: D313E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101894
Gene: ENSMUSG00000025575
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106288
AA Change: D313E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101895
Gene: ENSMUSG00000025575
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106289
AA Change: D350E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101896
Gene: ENSMUSG00000025575
AA Change: D350E

DomainStartEndE-ValueType
Pfam:Apyrase 115 216 6.3e-39 PFAM
Pfam:Apyrase 244 440 3.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164927
AA Change: D313E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126919
Gene: ENSMUSG00000025575
AA Change: D313E

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium-dependent nucleotidase that preferentially hydrolyzes UDP, GDP, and IDP. The encoded protein has low activity with ADP and ATP and shows no activity with AMP and GMP. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Cant1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Cant1 APN 11 118411062 missense probably benign 0.01
IGL02989:Cant1 APN 11 118411212 missense probably damaging 1.00
R0512:Cant1 UTSW 11 118411265 missense probably benign 0.26
R0535:Cant1 UTSW 11 118411143 missense probably damaging 1.00
R1953:Cant1 UTSW 11 118408783 missense probably damaging 1.00
R2154:Cant1 UTSW 11 118411437 missense probably damaging 1.00
R2187:Cant1 UTSW 11 118408841 nonsense probably null
R3916:Cant1 UTSW 11 118408746 missense probably damaging 0.98
R4786:Cant1 UTSW 11 118408839 missense possibly damaging 0.68
R4847:Cant1 UTSW 11 118410110 nonsense probably null
R5093:Cant1 UTSW 11 118411212 missense probably damaging 1.00
R5265:Cant1 UTSW 11 118408050 missense probably damaging 1.00
R5281:Cant1 UTSW 11 118408870 missense probably damaging 0.99
R5506:Cant1 UTSW 11 118411442 missense probably benign 0.10
R5614:Cant1 UTSW 11 118408743 missense probably benign
R6705:Cant1 UTSW 11 118407872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCGATTCTGCCATTGTC -3'
(R):5'- GACTCAGTGTAGCTTTCTGGC -3'

Sequencing Primer
(F):5'- GTCCTCTTCCGACTTGAGAG -3'
(R):5'- GTGAAGCCCCCAAAGTGTAGC -3'
Posted On2015-05-15