Incidental Mutation 'R4067:Kirrel1'
ID 316151
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 040853-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4067 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 86995774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 387 (Q387*)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,769,150 (GRCm39) T121S possibly damaging Het
4930503E14Rik T C 14: 44,406,641 (GRCm39) E136G probably damaging Het
Adgrg4 A G X: 56,005,320 (GRCm39) N2527S probably damaging Het
Ak1 G A 2: 32,519,593 (GRCm39) S7N probably benign Het
Aktip A C 8: 91,852,466 (GRCm39) I230R possibly damaging Het
Alms1 A G 6: 85,598,271 (GRCm39) I1032M probably damaging Het
Asb4 T A 6: 5,423,651 (GRCm39) V266E probably damaging Het
Bace1 G A 9: 45,765,962 (GRCm39) V130M probably damaging Het
Bglap A T 3: 88,291,744 (GRCm39) probably benign Het
Brpf3 T C 17: 29,040,233 (GRCm39) S885P probably benign Het
Chd9 A T 8: 91,750,202 (GRCm39) I1742F possibly damaging Het
Col9a2 T A 4: 120,909,586 (GRCm39) I415N probably damaging Het
Cybc1 A T 11: 121,115,528 (GRCm39) probably null Het
Dnajc7 T C 11: 100,492,607 (GRCm39) Y38C probably benign Het
Dync2i2 A G 2: 29,922,820 (GRCm39) L309P probably benign Het
Enam A G 5: 88,651,236 (GRCm39) Y840C probably damaging Het
Etnppl T A 3: 130,425,442 (GRCm39) C416S probably damaging Het
Fgf20 A T 8: 40,732,896 (GRCm39) S181T probably benign Het
Fut8 T A 12: 77,510,835 (GRCm39) Y421N probably damaging Het
Gcn1 T G 5: 115,737,147 (GRCm39) L1295R probably damaging Het
Gm11437 A G 11: 84,055,337 (GRCm39) V93A probably benign Het
Gm9989 T C 3: 81,829,549 (GRCm39) noncoding transcript Het
Gsdmc4 A T 15: 63,765,736 (GRCm39) probably null Het
Gvin3 T A 7: 106,198,772 (GRCm39) noncoding transcript Het
Ighv10-1 A T 12: 114,442,643 (GRCm39) M114K probably benign Het
Il22b T C 10: 118,126,115 (GRCm39) I161V probably damaging Het
Itfg2 T A 6: 128,387,413 (GRCm39) probably benign Het
Klk1 C T 7: 43,876,968 (GRCm39) R24* probably null Het
Klra7 T C 6: 130,208,612 (GRCm39) probably null Het
Ltn1 T C 16: 87,213,118 (GRCm39) Y481C possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mrps2 A G 2: 28,359,782 (GRCm39) N213S probably benign Het
Muc4 A T 16: 32,569,869 (GRCm39) I310F possibly damaging Het
Ntrk3 T A 7: 78,167,185 (GRCm39) Y102F probably damaging Het
Or8k24 A T 2: 86,216,431 (GRCm39) C110* probably null Het
Otof C T 5: 30,556,635 (GRCm39) G282D probably damaging Het
Pcdhb2 A T 18: 37,430,367 (GRCm39) probably null Het
Pign A T 1: 105,515,703 (GRCm39) probably null Het
Plekha6 G A 1: 133,222,416 (GRCm39) E1001K probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Ppm1d A G 11: 85,236,678 (GRCm39) T486A probably benign Het
Pudp A G 18: 50,701,329 (GRCm39) F135L probably benign Het
Rd3l T G 12: 111,945,945 (GRCm39) N178T probably benign Het
Rel A C 11: 23,703,215 (GRCm39) probably null Het
Sf3a1 T A 11: 4,117,824 (GRCm39) F195L probably damaging Het
Slc30a1 G C 1: 191,639,401 (GRCm39) A95P probably damaging Het
Slc47a2 T C 11: 61,194,773 (GRCm39) T469A probably benign Het
Slc4a10 A T 2: 61,876,989 (GRCm39) M1L probably benign Het
Slc8a1 T A 17: 81,955,703 (GRCm39) D445V probably damaging Het
Slc9a7 C T X: 20,071,793 (GRCm39) G113R probably damaging Het
Spata31e5 T A 1: 28,816,712 (GRCm39) D440V probably damaging Het
Spic T C 10: 88,511,545 (GRCm39) H237R possibly damaging Het
Stk26 A G X: 49,977,910 (GRCm39) E317G probably benign Het
Tex10 A T 4: 48,459,355 (GRCm39) Y506* probably null Het
Trhde T A 10: 114,280,585 (GRCm39) R848* probably null Het
Trpc5 T A X: 143,202,594 (GRCm39) R545* probably null Het
Usp24 C T 4: 106,216,286 (GRCm39) T379M possibly damaging Het
Zfp783 A T 6: 47,922,499 (GRCm39) noncoding transcript Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3196:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATAGGCAGGAAGACCCAGTC -3'
(R):5'- TTATTGCCAGCCTGCTTAGAGTC -3'

Sequencing Primer
(F):5'- TCAGGCCGGTCAGATCTCAG -3'
(R):5'- CCAGCCTGCTTAGAGTCTTAGG -3'
Posted On 2015-05-15