Incidental Mutation 'R2061:Madd'
ID316213
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene NameMAP-kinase activating death domain
SynonymsRab3 GEP, 9630059K23Rik
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2061 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91137360-91183837 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 91161486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381]
Predicted Effect unknown
Transcript: ENSMUST00000066420
AA Change: F1108L
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: F1108L

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111369
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111370
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111375
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154028
Meta Mutation Damage Score 0.0464 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Col12a1 T A 9: 79,617,705 I2725F possibly damaging Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dmbt1 T G 7: 131,099,133 C1014G possibly damaging Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Helz2 A G 2: 181,240,544 I152T probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kdm5a G T 6: 120,381,617 R207L probably benign Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tacr1 C T 6: 82,492,554 P140S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91175766 unclassified probably benign
IGL00781:Madd APN 2 91146928 missense probably benign 0.00
IGL00844:Madd APN 2 91167868 missense probably damaging 1.00
IGL00942:Madd APN 2 91170578 missense probably damaging 1.00
IGL01100:Madd APN 2 91158040 missense probably damaging 1.00
IGL01116:Madd APN 2 91154543 splice site probably benign
IGL01694:Madd APN 2 91157975 splice site probably benign
IGL01982:Madd APN 2 91175707 missense probably damaging 1.00
IGL02346:Madd APN 2 91162491 missense probably damaging 0.97
IGL02354:Madd APN 2 91162198 missense probably benign 0.17
IGL02361:Madd APN 2 91162198 missense probably benign 0.17
IGL02481:Madd APN 2 91178036 missense probably damaging 1.00
IGL02483:Madd APN 2 91178036 missense probably damaging 1.00
IGL02948:Madd APN 2 91142827 missense probably benign
IGL03338:Madd APN 2 91162162 missense possibly damaging 0.48
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0026:Madd UTSW 2 91175708 missense possibly damaging 0.88
R0027:Madd UTSW 2 91152549 missense probably damaging 0.97
R0085:Madd UTSW 2 91162738 missense probably benign 0.00
R0577:Madd UTSW 2 91138395 missense possibly damaging 0.88
R0587:Madd UTSW 2 91146885 missense probably damaging 1.00
R1112:Madd UTSW 2 91143599 missense probably damaging 1.00
R1722:Madd UTSW 2 91167637 missense probably benign
R1750:Madd UTSW 2 91167891 missense probably damaging 0.98
R2112:Madd UTSW 2 91176976 missense possibly damaging 0.89
R2114:Madd UTSW 2 91164022 missense probably damaging 1.00
R2140:Madd UTSW 2 91152509 missense possibly damaging 0.80
R2276:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2277:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2279:Madd UTSW 2 91143683 missense possibly damaging 0.67
R2424:Madd UTSW 2 91166622 missense probably damaging 1.00
R2904:Madd UTSW 2 91175672 missense probably damaging 1.00
R3122:Madd UTSW 2 91176209 missense probably damaging 1.00
R3836:Madd UTSW 2 91154643 critical splice donor site probably null
R3979:Madd UTSW 2 91176828 missense possibly damaging 0.81
R4151:Madd UTSW 2 91143083 missense probably benign 0.11
R4233:Madd UTSW 2 91178236 missense probably benign 0.26
R4236:Madd UTSW 2 91167028 missense probably benign 0.00
R4299:Madd UTSW 2 91169803 missense probably damaging 1.00
R4334:Madd UTSW 2 91140572 missense probably benign 0.08
R4413:Madd UTSW 2 91167587 missense probably damaging 1.00
R4595:Madd UTSW 2 91167664 missense possibly damaging 0.80
R4694:Madd UTSW 2 91160328 missense probably damaging 0.99
R5410:Madd UTSW 2 91154514 missense probably damaging 1.00
R5490:Madd UTSW 2 91170635 missense possibly damaging 0.80
R5560:Madd UTSW 2 91163545 missense probably damaging 1.00
R5661:Madd UTSW 2 91154433 critical splice donor site probably null
R5710:Madd UTSW 2 91154476 missense probably damaging 1.00
R5730:Madd UTSW 2 91158109 missense probably damaging 1.00
R5759:Madd UTSW 2 91162075 missense possibly damaging 0.94
R5768:Madd UTSW 2 91167829 missense probably damaging 1.00
R5822:Madd UTSW 2 91152533 missense probably damaging 1.00
R6125:Madd UTSW 2 91152452 critical splice donor site probably null
R6151:Madd UTSW 2 91165457 nonsense probably null
R6229:Madd UTSW 2 91143670 missense probably damaging 0.96
R6230:Madd UTSW 2 91143521 critical splice donor site probably null
R6245:Madd UTSW 2 91178104 missense probably benign 0.27
R6323:Madd UTSW 2 91161438 utr 3 prime probably null
R6456:Madd UTSW 2 91178191 missense probably benign
R6473:Madd UTSW 2 91167059 missense probably benign
R6878:Madd UTSW 2 91169857 missense probably damaging 1.00
R7060:Madd UTSW 2 91177107 missense probably damaging 1.00
R7065:Madd UTSW 2 91155057 missense probably benign 0.26
R7073:Madd UTSW 2 91162509 missense not run
R7124:Madd UTSW 2 91162048 missense not run
X0067:Madd UTSW 2 91152473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCCAAGAAGAGAGCTG -3'
(R):5'- TCATCTGGGTCTCTGCATCCAG -3'

Sequencing Primer
(F):5'- AGAAGAGAGCTGCTTCATTCCTCTG -3'
(R):5'- GTTTTCCCCCATCCAAGCATTACAAC -3'
Posted On2015-05-15