Incidental Mutation 'R2061:Helz2'
ID316221
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Namehelicase with zinc finger 2, transcriptional coactivator
SynonymsBC006779
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2061 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181227615-181242027 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181240544 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 152 (I152T)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
Predicted Effect probably damaging
Transcript: ENSMUST00000094203
AA Change: I152T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108831
AA Change: I152T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121484
AA Change: I152T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Col12a1 T A 9: 79,617,705 I2725F possibly damaging Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dmbt1 T G 7: 131,099,133 C1014G possibly damaging Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kdm5a G T 6: 120,381,617 R207L probably benign Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Madd A C 2: 91,161,486 probably benign Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tacr1 C T 6: 82,492,554 P140S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCACATACATGCAGTAG -3'
(R):5'- ACTACTATAGGCCAGGGTTGGG -3'

Sequencing Primer
(F):5'- CCCACATACATGCAGTAGTTTAAAGG -3'
(R):5'- GCTGTAGGCGTCACTGGAATAG -3'
Posted On2015-05-15