Incidental Mutation 'R2061:Kdm5a'
ID316243
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2061 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120381617 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 207 (R207L)
Ref Sequence ENSEMBL: ENSMUSP00000145021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108] [ENSMUST00000132009] [ENSMUST00000135802] [ENSMUST00000203373]
Predicted Effect probably benign
Transcript: ENSMUST00000005108
AA Change: R207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: R207L

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122505
Predicted Effect probably benign
Transcript: ENSMUST00000132009
AA Change: R207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145375
Gene: ENSMUSG00000030180
AA Change: R207L

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
JmjC 437 603 1.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135802
AA Change: R207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145021
Gene: ENSMUSG00000030180
AA Change: R207L

DomainStartEndE-ValueType
JmjN 18 59 1.7e-22 SMART
ARID 81 170 3.6e-39 SMART
BRIGHT 85 175 1.2e-33 SMART
PHD 295 341 7.3e-17 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 2.2e-75 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 6.3e-15 PFAM
Pfam:PLU-1 741 811 9.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203373
SMART Domains Protein: ENSMUSP00000144720
Gene: ENSMUSG00000030180

DomainStartEndE-ValueType
BRIGHT 1 53 8.4e-4 SMART
Blast:JmjC 58 153 3e-56 BLAST
PDB:2E6R|A 121 152 4e-9 PDB
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Col12a1 T A 9: 79,617,705 I2725F possibly damaging Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dmbt1 T G 7: 131,099,133 C1014G possibly damaging Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Helz2 A G 2: 181,240,544 I152T probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Madd A C 2: 91,161,486 probably benign Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tacr1 C T 6: 82,492,554 P140S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGGGACTTATCTGGAAACTTG -3'
(R):5'- CCCCAAATGATTAAGTTCATGAGATCC -3'

Sequencing Primer
(F):5'- CTGGAAACTTGCTAATTTTTCTACTC -3'
(R):5'- TGACAGCCAAAGTTGTGTCC -3'
Posted On2015-05-15