Incidental Mutation 'R4072:Olfr52'
ID316319
Institutional Source Beutler Lab
Gene Symbol Olfr52
Ensembl Gene ENSMUSG00000075199
Gene Nameolfactory receptor 52
SynonymsIE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86179412-86185683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86181647 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 155 (M155L)
Ref Sequence ENSEMBL: ENSMUSP00000097489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099905] [ENSMUST00000215138] [ENSMUST00000215171]
Predicted Effect probably benign
Transcript: ENSMUST00000099905
AA Change: M155L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097489
Gene: ENSMUSG00000075199
AA Change: M155L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-56 PFAM
Pfam:7tm_1 41 290 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215138
AA Change: M155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Olfr52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Olfr52 APN 2 86181595 unclassified probably null
R0422:Olfr52 UTSW 2 86181222 missense probably benign 0.00
R0688:Olfr52 UTSW 2 86181605 unclassified probably null
R0976:Olfr52 UTSW 2 86181808 missense probably damaging 0.99
R1240:Olfr52 UTSW 2 86182109 start codon destroyed possibly damaging 0.94
R1316:Olfr52 UTSW 2 86181365 missense probably benign 0.01
R1865:Olfr52 UTSW 2 86181538 missense probably damaging 1.00
R2188:Olfr52 UTSW 2 86181436 missense probably damaging 1.00
R4222:Olfr52 UTSW 2 86181997 missense probably damaging 0.99
R5096:Olfr52 UTSW 2 86181932 missense probably damaging 1.00
R5103:Olfr52 UTSW 2 86181616 missense probably benign 0.41
R5934:Olfr52 UTSW 2 86182102 missense probably benign 0.00
R6168:Olfr52 UTSW 2 86181965 missense probably damaging 0.99
R6601:Olfr52 UTSW 2 86181965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCGCATCCTCAGAATG -3'
(R):5'- CCATATCCTTCAATGCATGTGC -3'

Sequencing Primer
(F):5'- CATCCTCAGAATGGCAGAAATAATG -3'
(R):5'- GCATGTGCTGCCCAGTTAG -3'
Posted On2015-05-15