Incidental Mutation 'R4072:Tm2d3'
ID316340
Institutional Source Beutler Lab
Gene Symbol Tm2d3
Ensembl Gene ENSMUSG00000078681
Gene NameTM2 domain containing 3
Synonyms
MMRRC Submission 040854-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R4072 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65691169-65701913 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65697750 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 49 (L49*)
Ref Sequence ENSEMBL: ENSMUSP00000145545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032726] [ENSMUST00000065574] [ENSMUST00000107495] [ENSMUST00000129166] [ENSMUST00000143508] [ENSMUST00000206517] [ENSMUST00000206628] [ENSMUST00000206934]
Predicted Effect probably damaging
Transcript: ENSMUST00000032726
AA Change: C111S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032726
Gene: ENSMUSG00000078681
AA Change: C111S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 165 214 5.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065574
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064967
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 6.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107495
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103119
Gene: ENSMUSG00000078681
AA Change: C142S

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:TM2 196 245 5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129166
AA Change: C142S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000143508
SMART Domains Protein: ENSMUSP00000116848
Gene: ENSMUSG00000078681

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000206361
AA Change: C85S
Predicted Effect probably damaging
Transcript: ENSMUST00000206517
AA Change: C133S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206628
AA Change: C113S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206837
Predicted Effect probably null
Transcript: ENSMUST00000206934
AA Change: L49*
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. Several alternatively spliced transcript variants of this gene are described but the full length nature of some variants has not been determined. Multiple polyadenylation sites have been found in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,361 probably null Het
Abcc5 A G 16: 20,333,695 I1367T probably damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Acss3 C T 10: 107,123,585 probably benign Het
Ankar G T 1: 72,688,592 D169E probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atp4a T C 7: 30,715,332 I182T probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Baz1a A G 12: 54,941,560 I268T probably benign Het
Baz2b A T 2: 59,912,573 probably null Het
C2cd4d C A 3: 94,363,878 C150* probably null Het
Crtac1 T C 19: 42,304,707 Y321C probably damaging Het
Dnah11 T C 12: 118,106,492 H1526R probably damaging Het
Dnah5 A T 15: 28,340,298 R2284* probably null Het
Dnah9 T C 11: 66,084,904 T1440A probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Eva1c T A 16: 90,904,131 F331Y probably damaging Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Galntl5 A T 5: 25,198,480 K150* probably null Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm19965 A G 1: 116,821,071 T161A probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Hydin G A 8: 110,505,256 E1617K possibly damaging Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Obscn A G 11: 58,997,183 I7652T unknown Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr52 T A 2: 86,181,647 M155L probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde7a G A 3: 19,256,853 R70C probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Pms2 T C 5: 143,929,001 I742T probably damaging Het
Pot1a T C 6: 25,752,357 probably null Het
Rp1l1 A T 14: 64,028,132 E389V probably damaging Het
Scnn1a A G 6: 125,338,907 N407S probably damaging Het
Slc30a7 T C 3: 115,946,680 D374G probably damaging Het
Slco2a1 T A 9: 103,068,002 I192N probably damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tox T C 4: 6,842,396 T45A probably damaging Het
Usp31 A G 7: 121,667,782 probably null Het
Vwc2 T A 11: 11,116,446 L178Q probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Other mutations in Tm2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tm2d3 APN 7 65695222 nonsense probably null
IGL02312:Tm2d3 APN 7 65699169 critical splice donor site probably null
R0115:Tm2d3 UTSW 7 65695334 intron probably benign
R0265:Tm2d3 UTSW 7 65697834 missense possibly damaging 0.60
R2143:Tm2d3 UTSW 7 65695239 missense probably damaging 1.00
R4074:Tm2d3 UTSW 7 65697750 nonsense probably null
R4075:Tm2d3 UTSW 7 65697750 nonsense probably null
R4076:Tm2d3 UTSW 7 65697750 nonsense probably null
R4351:Tm2d3 UTSW 7 65695191 missense probably damaging 1.00
R4966:Tm2d3 UTSW 7 65697721 missense possibly damaging 0.81
R5381:Tm2d3 UTSW 7 65701672 missense probably damaging 1.00
R5571:Tm2d3 UTSW 7 65699124 missense probably damaging 1.00
R5621:Tm2d3 UTSW 7 65701618 missense probably damaging 1.00
R6819:Tm2d3 UTSW 7 65697778 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGATGCTACATACGAGCCTTC -3'
(R):5'- CCAAGGGTCTTTCTGAGAACTG -3'

Sequencing Primer
(F):5'- ACGAGCCTTCTTCCTATATGAACTG -3'
(R):5'- CTCAAGTGTGGCTAAGGGCTC -3'
Posted On2015-05-15