Incidental Mutation 'R4074:Tesk1'
ID316446
Institutional Source Beutler Lab
Gene Symbol Tesk1
Ensembl Gene ENSMUSG00000028458
Gene Nametestis specific protein kinase 1
Synonyms
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43441939-43448064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43443606 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 58 (I58V)
Ref Sequence ENSEMBL: ENSMUSP00000121067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030179] [ENSMUST00000060864] [ENSMUST00000098104] [ENSMUST00000098105] [ENSMUST00000107925] [ENSMUST00000107926] [ENSMUST00000138981]
Predicted Effect probably benign
Transcript: ENSMUST00000030179
SMART Domains Protein: ENSMUSP00000030179
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 348 2.28e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060864
AA Change: I58V

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050087
Gene: ENSMUSG00000028458
AA Change: I58V

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 306 5.4e-46 PFAM
Pfam:Pkinase_Tyr 52 306 3.1e-47 PFAM
low complexity region 316 330 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 403 424 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098104
SMART Domains Protein: ENSMUSP00000095708
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
coiled coil region 83 169 N/A INTRINSIC
CLECT 178 287 2.48e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098105
SMART Domains Protein: ENSMUSP00000095709
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 113 199 N/A INTRINSIC
CLECT 208 324 2.28e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107925
SMART Domains Protein: ENSMUSP00000103558
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 334 2.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107926
SMART Domains Protein: ENSMUSP00000103559
Gene: ENSMUSG00000028459

DomainStartEndE-ValueType
low complexity region 44 60 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
coiled coil region 137 223 N/A INTRINSIC
CLECT 232 341 2.48e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137178
Predicted Effect possibly damaging
Transcript: ENSMUST00000138981
AA Change: I58V

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121067
Gene: ENSMUSG00000028458
AA Change: I58V

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
Pfam:Pkinase 52 174 7.6e-29 PFAM
Pfam:Pkinase_Tyr 52 175 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156810
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Tesk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Tesk1 APN 4 43445820 critical splice donor site probably null
IGL02969:Tesk1 APN 4 43447027 missense possibly damaging 0.49
IGL02969:Tesk1 APN 4 43447026 nonsense probably null
FR4449:Tesk1 UTSW 4 43447002 utr 3 prime probably benign
FR4737:Tesk1 UTSW 4 43447004 frame shift probably null
R0009:Tesk1 UTSW 4 43445368 missense probably damaging 0.99
R0396:Tesk1 UTSW 4 43446000 missense probably damaging 0.99
R0765:Tesk1 UTSW 4 43446706 missense possibly damaging 0.81
R1850:Tesk1 UTSW 4 43443576 missense probably damaging 1.00
R1868:Tesk1 UTSW 4 43447201 missense probably damaging 0.99
R1903:Tesk1 UTSW 4 43446998 missense probably benign 0.00
R3961:Tesk1 UTSW 4 43445133 splice site probably null
R3973:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3975:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R3976:Tesk1 UTSW 4 43445786 missense possibly damaging 0.50
R4908:Tesk1 UTSW 4 43445555 nonsense probably null
R5002:Tesk1 UTSW 4 43444573 missense probably damaging 1.00
R5237:Tesk1 UTSW 4 43447100 missense probably damaging 0.98
R6755:Tesk1 UTSW 4 43445991 missense probably benign 0.03
R6886:Tesk1 UTSW 4 43443592 missense possibly damaging 0.72
R6991:Tesk1 UTSW 4 43447006 missense probably benign
R6992:Tesk1 UTSW 4 43447006 missense probably benign
R6993:Tesk1 UTSW 4 43447006 missense probably benign
X0064:Tesk1 UTSW 4 43443534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGTTAACCGCAGACC -3'
(R):5'- ATGACTTGTCCCGACTGTCG -3'

Sequencing Primer
(F):5'- ATCCGGCCATGTGAAGCAG -3'
(R):5'- TGCCGAACCTGGGGGAG -3'
Posted On2015-05-15