Incidental Mutation 'R4074:Tuba8'
ID316460
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Nametubulin, alpha 8
Synonyms
MMRRC Submission 040855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4074 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121210696-121226854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121222797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 147 (S147T)
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
Predicted Effect probably damaging
Transcript: ENSMUST00000032233
AA Change: S147T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137
AA Change: S147T

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124853
Meta Mutation Damage Score 0.424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably null Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Gnb3 T A 6: 124,836,979 E215D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121220511 missense probably benign
IGL02725:Tuba8 APN 6 121225957 nonsense probably null
IGL03091:Tuba8 APN 6 121220444 missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121222954 missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121225904 missense probably benign 0.37
R1424:Tuba8 UTSW 6 121220511 missense probably benign
R1624:Tuba8 UTSW 6 121220426 missense probably damaging 1.00
R1741:Tuba8 UTSW 6 121222768 missense possibly damaging 0.95
R1985:Tuba8 UTSW 6 121220520 missense probably benign 0.00
R2513:Tuba8 UTSW 6 121225973 missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R4875:Tuba8 UTSW 6 121226083 utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121220589 missense probably damaging 1.00
R5073:Tuba8 UTSW 6 121222903 missense probably damaging 0.99
R5444:Tuba8 UTSW 6 121226101 utr 3 prime probably benign
R5546:Tuba8 UTSW 6 121222913 nonsense probably null
R5594:Tuba8 UTSW 6 121225904 missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121225895 missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121222912 missense probably damaging 1.00
R7489:Tuba8 UTSW 6 121226021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGAGGATGGACTTATGGCAG -3'
(R):5'- TGCGGCAGATGTCGTAGATG -3'

Sequencing Primer
(F):5'- TGGACTTATGGCAGACAGTG -3'
(R):5'- GGCTTCGTTATCCACCATGAAAG -3'
Posted On2015-05-15