Incidental Mutation 'R0391:Mbd5'
ID31663
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0391 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49272416 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 970 (V970A)
Ref Sequence ENSEMBL: ENSMUSP00000036847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112754] [ENSMUST00000132717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047413
AA Change: V970A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: V970A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112754
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: V709A
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: V709A

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132717
AA Change: V78A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137021
Gene: ENSMUSG00000036792
AA Change: V78A

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 42 56 N/A INTRINSIC
low complexity region 100 118 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
low complexity region 220 244 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 314 337 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 424 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Nod2 T G 8: 88,663,778 S238A probably benign Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGTAGGTGGTTCAAGCCTGCCG -3'
(R):5'- TTAATCCTGAGGCCCCAGTGACAG -3'

Sequencing Primer
(F):5'- GACAACATCTGTTCTCCAAGATGG -3'
(R):5'- AGTGTCACTGCCTGCTAAAG -3'
Posted On2013-04-24