Incidental Mutation 'R4078:Olfr365'
ID316665
Institutional Source Beutler Lab
Gene Symbol Olfr365
Ensembl Gene ENSMUSG00000059429
Gene Nameolfactory receptor 365
SynonymsGA_x6K02T2NLDC-33885305-33886243, MOR138-1
MMRRC Submission 041623-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37188198-37206019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37202012 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 257 (I257N)
Ref Sequence ENSEMBL: ENSMUSP00000151617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074168] [ENSMUST00000213969] [ENSMUST00000218602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074168
AA Change: I257N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073801
Gene: ENSMUSG00000059429
AA Change: I257N

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:7tm_4 33 309 4.7e-58 PFAM
Pfam:7tm_1 43 292 2.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213969
AA Change: I257N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218602
AA Change: I257N

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (70/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik A T 9: 46,304,061 L367* probably null Het
Agfg1 T A 1: 82,882,287 S312T possibly damaging Het
Akap8 C T 17: 32,312,298 R380Q probably damaging Het
Ambp T A 4: 63,150,443 K112N probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Asah1 A G 8: 41,354,082 S102P probably damaging Het
Atp10b T C 11: 43,153,283 V112A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cabs1 G A 5: 87,980,302 E271K probably damaging Het
Car8 T C 4: 8,169,731 K259R possibly damaging Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdh4 A G 2: 179,889,173 E616G possibly damaging Het
Cdk11b C T 4: 155,639,747 probably benign Het
Cfap74 A G 4: 155,455,671 D975G probably damaging Het
Col27a1 G T 4: 63,224,432 R119L probably damaging Het
Col7a1 A G 9: 108,960,991 N918S unknown Het
Colec11 T C 12: 28,595,247 N142D possibly damaging Het
Cox7a2 G A 9: 79,758,570 Q10* probably null Het
Cyp2b23 C A 7: 26,673,092 G366V probably damaging Het
Emsy G A 7: 98,590,725 P1108S probably damaging Het
Etl4 A T 2: 20,807,961 R1442S probably damaging Het
Fam151a G A 4: 106,747,757 G439S probably benign Het
Fat1 C T 8: 44,989,122 P1154S probably damaging Het
Fat4 G A 3: 38,980,020 S2607N probably damaging Het
Fzd7 T A 1: 59,483,789 M277K possibly damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10436 T A 12: 88,175,913 I312F probably benign Het
Gm2016 A G 12: 87,876,631 K16R unknown Het
Gm38706 G T 6: 130,483,737 noncoding transcript Het
Gm9758 T A 5: 14,911,522 probably null Het
Gpr3 T C 4: 133,210,915 T149A probably damaging Het
Heatr9 C A 11: 83,512,428 K428N probably benign Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Kcnn3 A G 3: 89,661,188 K591R possibly damaging Het
Khdrbs2 T C 1: 32,519,814 probably benign Het
Lpp G A 16: 24,681,861 R141H probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Macf1 T A 4: 123,472,091 Q2959L probably benign Het
Mipep T A 14: 60,846,477 Y606N probably damaging Het
Mroh5 C A 15: 73,786,040 C547F possibly damaging Het
Nek3 A T 8: 22,132,137 W363R probably damaging Het
Nphs1 T A 7: 30,467,520 Y717* probably null Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr167 T A 16: 19,515,232 M135L possibly damaging Het
Olfr508 T A 7: 108,630,907 M305K probably benign Het
Olfr824 G A 10: 130,126,718 T113I probably damaging Het
Optc T C 1: 133,898,349 H270R probably damaging Het
Pik3c2g A G 6: 139,635,610 probably benign Het
Pms1 A T 1: 53,267,789 probably null Het
Prkg1 T C 19: 31,585,578 Y156C probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Slc22a28 T A 19: 8,101,413 H304L probably benign Het
Stox1 C T 10: 62,666,031 C250Y probably benign Het
Sult2a3 A G 7: 14,121,737 W65R possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Syne2 C A 12: 76,035,624 T4857K probably damaging Het
Tcp1 T C 17: 12,918,083 L64S probably benign Het
Thap11 G T 8: 105,855,916 E186* probably null Het
Tmem67 A G 4: 12,040,633 probably null Het
Trappc10 T C 10: 78,210,382 Y458C probably damaging Het
Ufd1 A G 16: 18,825,778 Y197C possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp49 A G 17: 47,674,749 T245A probably damaging Het
Washc1 A T 17: 66,117,161 E289D probably benign Het
Zc3h7a A T 16: 11,151,147 V450E probably benign Het
Zcchc17 T G 4: 130,329,625 I123L possibly damaging Het
Zfp955a A G 17: 33,241,701 Y486H probably benign Het
Other mutations in Olfr365
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Olfr365 APN 2 37201597 missense probably damaging 1.00
IGL00943:Olfr365 APN 2 37202171 missense probably benign 0.08
IGL01100:Olfr365 APN 2 37201640 missense possibly damaging 0.58
IGL01696:Olfr365 APN 2 37201511 missense probably benign 0.00
IGL02119:Olfr365 APN 2 37201269 missense possibly damaging 0.73
IGL02807:Olfr365 APN 2 37201574 missense probably damaging 1.00
IGL03030:Olfr365 APN 2 37201871 missense probably benign 0.00
R0388:Olfr365 UTSW 2 37202184 unclassified probably null
R0788:Olfr365 UTSW 2 37202023 missense possibly damaging 0.90
R1126:Olfr365 UTSW 2 37202101 missense probably benign
R1753:Olfr365 UTSW 2 37201427 missense probably damaging 1.00
R1822:Olfr365 UTSW 2 37201980 missense probably damaging 1.00
R1837:Olfr365 UTSW 2 37202102 missense probably benign 0.23
R3711:Olfr365 UTSW 2 37201273 missense probably benign
R4077:Olfr365 UTSW 2 37202012 missense possibly damaging 0.79
R4375:Olfr365 UTSW 2 37201562 missense probably benign 0.33
R4607:Olfr365 UTSW 2 37202082 nonsense probably null
R4608:Olfr365 UTSW 2 37202082 nonsense probably null
R4889:Olfr365 UTSW 2 37202045 missense probably damaging 1.00
R5398:Olfr365 UTSW 2 37201318 missense probably benign 0.33
R5560:Olfr365 UTSW 2 37201930 missense probably benign 0.01
R5670:Olfr365 UTSW 2 37201994 missense probably benign 0.19
R6108:Olfr365 UTSW 2 37201766 missense possibly damaging 0.68
R6727:Olfr365 UTSW 2 37202106 missense probably damaging 1.00
R6860:Olfr365 UTSW 2 37202177 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATACTCAGCCTGTGTTGAAGC -3'
(R):5'- TGTCTACAGGTGAACTTTACCC -3'

Sequencing Primer
(F):5'- ACATCCTCCAGCCAGATTGTG -3'
(R):5'- AGGTGAACTTTACCCATTAACTTCC -3'
Posted On2015-05-15