Incidental Mutation 'R4079:Olfr1037'
ID316733
Institutional Source Beutler Lab
Gene Symbol Olfr1037
Ensembl Gene ENSMUSG00000075205
Gene Nameolfactory receptor 1037
SynonymsMOR171-52, MOR256-34P, GA_x6K02T2Q125-47560740-47559775
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86084671-86087385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86085312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 155 (V155A)
Ref Sequence ENSEMBL: ENSMUSP00000150319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099911] [ENSMUST00000213333] [ENSMUST00000216020] [ENSMUST00000216886]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099911
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097495
Gene: ENSMUSG00000075205
AA Change: V155A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213333
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216020
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216886
AA Change: V155A

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.0448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Olfr1037
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Olfr1037 APN 2 86085640 missense probably benign 0.05
IGL02534:Olfr1037 APN 2 86085369 missense probably damaging 1.00
IGL03204:Olfr1037 APN 2 86085671 nonsense probably null
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0054:Olfr1037 UTSW 2 86085361 missense probably benign 0.38
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0131:Olfr1037 UTSW 2 86085500 missense probably damaging 1.00
R0666:Olfr1037 UTSW 2 86085213 missense probably benign 0.03
R0732:Olfr1037 UTSW 2 86085584 missense probably benign 0.00
R1167:Olfr1037 UTSW 2 86085291 missense probably benign 0.16
R1899:Olfr1037 UTSW 2 86085720 missense probably benign
R3082:Olfr1037 UTSW 2 86085709 missense probably benign
R3847:Olfr1037 UTSW 2 86085407 nonsense probably null
R3848:Olfr1037 UTSW 2 86085407 nonsense probably null
R4193:Olfr1037 UTSW 2 86085700 missense probably benign 0.01
R4832:Olfr1037 UTSW 2 86084846 missense probably benign 0.00
R5244:Olfr1037 UTSW 2 86084956 missense probably damaging 1.00
R5643:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5644:Olfr1037 UTSW 2 86085159 missense probably damaging 0.98
R5974:Olfr1037 UTSW 2 86084881 missense probably benign
R6136:Olfr1037 UTSW 2 86084901 missense probably damaging 1.00
R6189:Olfr1037 UTSW 2 86084913 missense possibly damaging 0.53
R6483:Olfr1037 UTSW 2 86085440 missense probably benign 0.00
R6569:Olfr1037 UTSW 2 86085505 missense possibly damaging 0.87
R6724:Olfr1037 UTSW 2 86085357 missense possibly damaging 0.81
R6867:Olfr1037 UTSW 2 86085738 missense possibly damaging 0.59
X0062:Olfr1037 UTSW 2 86085114 missense probably damaging 1.00
Z1088:Olfr1037 UTSW 2 86084982 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTCCTTCTGTGGACTGG -3'
(R):5'- CCCCAAGTTTCTGGAGACTC -3'

Sequencing Primer
(F):5'- TGGACTGGATTCTTAAGATAGCAGCC -3'
(R):5'- ACAGAAGGTCTATATCTTTCTACGCC -3'
Posted On2015-05-15