Incidental Mutation 'R4079:Slc12a1'
ID316735
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125200623 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 733 (N733I)
Ref Sequence ENSEMBL: ENSMUSP00000028630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028630
AA Change: N733I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: N733I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110494
AA Change: N733I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: N733I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110495
AA Change: N733I

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: N733I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0127:Slc12a1 UTSW 2 125219762 missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACAAGGTTCTGGACAAACTTC -3'
(R):5'- TGCGCTGATCTCCTACACTG -3'

Sequencing Primer
(F):5'- GACAAACTTCATTTAAGGAGGTGCC -3'
(R):5'- ACACTGCCTTGTGACTGG -3'
Posted On2015-05-15