Incidental Mutation 'R4079:Usp32'
ID316768
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85039229 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 574 (Y574F)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000172515]
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: Y574F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: Y574F

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172515
SMART Domains Protein: ENSMUSP00000133781
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Blast:DUSP 1 52 7e-30 BLAST
low complexity region 53 65 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174602
AA Change: Y52F
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804
AA Change: Y52F

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGAACTCTGCTACCATAAGGAAAG -3'
(R):5'- AGGCTGGGAATATAGCTCAGC -3'

Sequencing Primer
(F):5'- CAACTAGGAAAATTCACACAGAAAAG -3'
(R):5'- ACAGTACAGGATCCATCAAAAATTG -3'
Posted On2015-05-15