Incidental Mutation 'R4079:Serpina3a'
ID316772
Institutional Source Beutler Lab
Gene Symbol Serpina3a
Ensembl Gene ENSMUSG00000041536
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3A
Synonyms4933406L18Rik, antitrypsin, alpha-1 antiproteinase,
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4079 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104112724-104121896 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 104119675 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 320 (Q320*)
Ref Sequence ENSEMBL: ENSMUSP00000140024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021496] [ENSMUST00000109965] [ENSMUST00000185595]
Predicted Effect probably null
Transcript: ENSMUST00000021496
AA Change: Q320*
SMART Domains Protein: ENSMUSP00000021496
Gene: ENSMUSG00000041536
AA Change: Q320*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109965
AA Change: Q130*
SMART Domains Protein: ENSMUSP00000105591
Gene: ENSMUSG00000041536
AA Change: Q130*

DomainStartEndE-ValueType
SERPIN 4 229 5.39e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185595
AA Change: Q320*
SMART Domains Protein: ENSMUSP00000140024
Gene: ENSMUSG00000041536
AA Change: Q320*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 58 419 1.73e-151 SMART
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Ung G T 5: 114,130,623 probably null Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Serpina3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Serpina3a APN 12 104121499 missense probably benign 0.05
IGL02003:Serpina3a APN 12 104116000 missense probably benign 0.02
IGL02379:Serpina3a APN 12 104118660 missense probably benign 0.00
IGL02547:Serpina3a APN 12 104116543 missense probably damaging 0.98
IGL02593:Serpina3a APN 12 104118432 missense probably benign 0.01
IGL02730:Serpina3a APN 12 104119663 missense probably damaging 1.00
IGL02953:Serpina3a APN 12 104116489 missense probably benign 0.00
IGL03197:Serpina3a APN 12 104116241 missense probably damaging 1.00
R1184:Serpina3a UTSW 12 104116528 nonsense probably null
R1635:Serpina3a UTSW 12 104116478 missense probably damaging 1.00
R1688:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R1804:Serpina3a UTSW 12 104118416 splice site probably benign
R1867:Serpina3a UTSW 12 104118627 missense probably benign 0.01
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R1888:Serpina3a UTSW 12 104116103 missense probably benign 0.16
R2110:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2111:Serpina3a UTSW 12 104116222 missense probably damaging 0.97
R2305:Serpina3a UTSW 12 104116528 missense probably benign 0.05
R2326:Serpina3a UTSW 12 104116499 missense probably benign 0.01
R2405:Serpina3a UTSW 12 104121318 missense possibly damaging 0.50
R4008:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4010:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4011:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R4091:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4092:Serpina3a UTSW 12 104116366 missense probably benign 0.01
R4210:Serpina3a UTSW 12 104118643 missense probably benign 0.06
R5064:Serpina3a UTSW 12 104116189 missense probably benign 0.01
R6242:Serpina3a UTSW 12 104116001 missense probably benign 0.10
R6337:Serpina3a UTSW 12 104112878 missense probably benign 0.36
R6395:Serpina3a UTSW 12 104116451 missense probably damaging 0.99
R6683:Serpina3a UTSW 12 104119637 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACTTTCATGGTCTAGGCATGG -3'
(R):5'- GAGGAATCTCAGTCATGCAGG -3'

Sequencing Primer
(F):5'- GGTGGAAAGAGGACTCTGCTCC -3'
(R):5'- AGGAATCTCAGTCATGCAGGTTTTC -3'
Posted On2015-05-15