Incidental Mutation 'R4080:Frmpd1'
ID316799
Institutional Source Beutler Lab
Gene Symbol Frmpd1
Ensembl Gene ENSMUSG00000035615
Gene NameFERM and PDZ domain containing 1
Synonyms
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location45184875-45285936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45284382 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1068 (C1068S)
Ref Sequence ENSEMBL: ENSMUSP00000103434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044773] [ENSMUST00000107804]
Predicted Effect probably benign
Transcript: ENSMUST00000044773
AA Change: C1068S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047232
Gene: ENSMUSG00000035615
AA Change: C1068S

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107804
AA Change: C1068S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103434
Gene: ENSMUSG00000035615
AA Change: C1068S

DomainStartEndE-ValueType
PDZ 67 135 5.72e-10 SMART
B41 177 401 4.85e-30 SMART
low complexity region 523 537 N/A INTRINSIC
low complexity region 578 597 N/A INTRINSIC
PDB:4G2V|B 901 938 2e-15 PDB
low complexity region 962 980 N/A INTRINSIC
low complexity region 1019 1030 N/A INTRINSIC
low complexity region 1115 1130 N/A INTRINSIC
Blast:B41 1264 1488 3e-44 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Frmpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Frmpd1 APN 4 45279456 missense possibly damaging 0.61
IGL01678:Frmpd1 APN 4 45243717 missense probably damaging 1.00
IGL01815:Frmpd1 APN 4 45284239 missense probably benign
IGL02305:Frmpd1 APN 4 45249209 missense probably damaging 1.00
IGL02347:Frmpd1 APN 4 45270023 splice site probably null
IGL02586:Frmpd1 APN 4 45285160 missense probably damaging 1.00
IGL02704:Frmpd1 APN 4 45285082 missense possibly damaging 0.83
IGL02942:Frmpd1 APN 4 45285493 missense probably damaging 0.99
IGL03353:Frmpd1 APN 4 45261926 missense probably damaging 1.00
IGL03355:Frmpd1 APN 4 45279140 missense probably damaging 1.00
IGL03401:Frmpd1 APN 4 45284383 missense probably benign 0.28
IGL03047:Frmpd1 UTSW 4 45283993 missense probably damaging 1.00
R0094:Frmpd1 UTSW 4 45284899 nonsense probably null
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0103:Frmpd1 UTSW 4 45229884 missense probably damaging 0.99
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0109:Frmpd1 UTSW 4 45279340 missense probably benign 0.03
R0375:Frmpd1 UTSW 4 45284196 missense probably benign 0.00
R0508:Frmpd1 UTSW 4 45284938 missense unknown
R0524:Frmpd1 UTSW 4 45256902 missense probably damaging 1.00
R0524:Frmpd1 UTSW 4 45283774 missense probably benign 0.00
R0625:Frmpd1 UTSW 4 45284055 missense probably benign
R0825:Frmpd1 UTSW 4 45285394 missense possibly damaging 0.93
R0926:Frmpd1 UTSW 4 45268497 missense probably damaging 1.00
R0975:Frmpd1 UTSW 4 45279000 missense probably benign 0.01
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1465:Frmpd1 UTSW 4 45273197 missense probably damaging 1.00
R1573:Frmpd1 UTSW 4 45283932 missense probably benign 0.01
R1938:Frmpd1 UTSW 4 45283711 missense probably damaging 1.00
R2334:Frmpd1 UTSW 4 45285408 missense probably damaging 0.97
R2413:Frmpd1 UTSW 4 45278969 missense probably benign 0.02
R2760:Frmpd1 UTSW 4 45244667 missense possibly damaging 0.77
R3856:Frmpd1 UTSW 4 45283698 missense probably damaging 1.00
R3876:Frmpd1 UTSW 4 45284093 missense probably benign 0.01
R4597:Frmpd1 UTSW 4 45274441 missense probably benign 0.12
R4714:Frmpd1 UTSW 4 45284785 missense probably benign 0.11
R4779:Frmpd1 UTSW 4 45229865 missense probably damaging 1.00
R4957:Frmpd1 UTSW 4 45273099 missense probably damaging 1.00
R5000:Frmpd1 UTSW 4 45261931 splice site probably null
R5041:Frmpd1 UTSW 4 45278878 missense probably damaging 1.00
R5228:Frmpd1 UTSW 4 45284322 missense probably damaging 0.98
R5413:Frmpd1 UTSW 4 45249196 missense probably benign 0.00
R5560:Frmpd1 UTSW 4 45243697 missense probably damaging 1.00
R6133:Frmpd1 UTSW 4 45284915 missense probably benign 0.01
R6158:Frmpd1 UTSW 4 45285401 missense probably damaging 1.00
R6329:Frmpd1 UTSW 4 45268551 missense possibly damaging 0.80
R6338:Frmpd1 UTSW 4 45274489 missense probably benign 0.00
R6544:Frmpd1 UTSW 4 45279024 missense probably damaging 1.00
R6728:Frmpd1 UTSW 4 45284664 missense probably benign
R6748:Frmpd1 UTSW 4 45274397 missense probably benign 0.08
R6798:Frmpd1 UTSW 4 45284850 missense probably benign 0.17
R6828:Frmpd1 UTSW 4 45275383 missense probably damaging 0.99
R7002:Frmpd1 UTSW 4 45284200 missense probably benign
R7258:Frmpd1 UTSW 4 45269974 missense possibly damaging 0.79
R7295:Frmpd1 UTSW 4 45285700 missense probably damaging 1.00
R7382:Frmpd1 UTSW 4 45278880 missense probably benign 0.00
R7423:Frmpd1 UTSW 4 45256948 missense probably damaging 1.00
R7451:Frmpd1 UTSW 4 45279558 missense probably benign 0.11
R7492:Frmpd1 UTSW 4 45285237 missense possibly damaging 0.71
R7524:Frmpd1 UTSW 4 45271181 missense probably benign 0.16
Z1088:Frmpd1 UTSW 4 45284080 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTCCAGATCAAGACCCAGGTG -3'
(R):5'- TTGGAATCACCCAGGTCCTTC -3'

Sequencing Primer
(F):5'- GAACTCACTGCAGAGCCTGAG -3'
(R):5'- ACCCAGGTCCTTCCCAGATC -3'
Posted On2015-05-15