Incidental Mutation 'R4080:Kcnh8'
ID316850
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 040856-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4080 (G1)
Quality Score217
Status Not validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA at 52725906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adam7 T C 14: 68,520,539 T245A probably benign Het
Adgrf3 G A 5: 30,197,369 Q554* probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Aspm C A 1: 139,470,755 Q1024K probably damaging Het
C7 T C 15: 4,990,464 S734G probably benign Het
Ccdc158 A T 5: 92,623,396 S987T probably benign Het
Chrna2 G T 14: 66,143,417 G45V probably benign Het
Chrna2 C A 14: 66,143,424 Y47* probably null Het
Clec2g C A 6: 128,981,324 Q117K probably damaging Het
Cntnap5a A G 1: 116,101,574 S253G probably benign Het
Cttn T A 7: 144,457,724 D116V probably damaging Het
Cyp2c40 A G 19: 39,802,529 V286A probably benign Het
Dcbld2 T A 16: 58,465,373 S632T probably damaging Het
Dscam A T 16: 96,683,772 N1118K probably benign Het
Eif2a C T 3: 58,539,629 T92M possibly damaging Het
Frmpd1 T A 4: 45,284,382 C1068S probably benign Het
Fstl1 G A 16: 37,822,603 V110I probably benign Het
Gpat2 T C 2: 127,433,622 I465T probably damaging Het
Gpr137 C T 19: 6,940,423 probably benign Het
Hgsnat A G 8: 25,946,343 I561T probably benign Het
Ift74 T A 4: 94,652,912 probably null Het
Ilf3 A G 9: 21,403,134 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrrc41 C A 4: 116,080,546 probably null Het
Myh11 C A 16: 14,224,059 R700L possibly damaging Het
Myo16 A G 8: 10,562,240 D1295G probably damaging Het
Myo5b A G 18: 74,740,488 M1488V probably benign Het
Naip6 A T 13: 100,299,307 Y903N probably damaging Het
Nek6 A G 2: 38,550,637 H19R probably damaging Het
Nktr A C 9: 121,741,126 T127P probably damaging Het
Noc4l A T 5: 110,649,872 D335E probably benign Het
Nsd1 A G 13: 55,301,809 D1993G probably damaging Het
Olfr1377 G A 11: 50,984,856 D52N probably damaging Het
Olfr190 A T 16: 59,074,256 F275I probably damaging Het
Pabpc2 A T 18: 39,775,530 Q616L possibly damaging Het
Pcdhga4 A T 18: 37,685,779 D127V probably damaging Het
Phrf1 T C 7: 141,259,720 probably benign Het
Phtf2 T A 5: 20,813,296 I16F probably damaging Het
Plekhg3 G T 12: 76,577,981 R1200L probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prss12 A G 3: 123,485,485 N404D probably benign Het
Ptch2 C G 4: 117,111,206 A926G probably damaging Het
Ptpa T C 2: 30,443,305 F6L probably damaging Het
Reck T C 4: 43,942,293 I853T possibly damaging Het
Reep6 G A 10: 80,330,162 probably benign Het
Rex2 T A 4: 147,058,697 S547R probably benign Het
Rgs22 C T 15: 36,107,076 E55K probably damaging Het
Rtl6 T C 15: 84,557,001 T65A possibly damaging Het
Scarb1 G T 5: 125,277,795 P491Q probably damaging Het
Scfd1 A G 12: 51,431,519 S505G probably benign Het
Scube1 T G 15: 83,608,747 Q904P probably damaging Het
Sis T C 3: 72,921,184 Y1186C probably damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Spty2d1 T C 7: 46,998,581 E200G probably damaging Het
Stard13 C A 5: 151,092,829 probably null Het
Sybu T C 15: 44,718,943 K95R probably damaging Het
Trappc9 T A 15: 72,941,947 D488V probably damaging Het
Txk G A 5: 72,700,663 P381S probably damaging Het
Ubr2 A T 17: 46,988,722 M198K probably benign Het
Unc5a A T 13: 55,004,481 T786S possibly damaging Het
Unc93b1 G A 19: 3,941,959 R231Q probably damaging Het
Wfdc1 T A 8: 119,683,793 probably null Het
Zfp667 T G 7: 6,305,106 C258G possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGACTGAAGTTGTGTC -3'
(R):5'- CATGTTCCCTGGAGAACTTCTC -3'

Sequencing Primer
(F):5'- GCCTGACTGAAGTTGTGTCTTAAAC -3'
(R):5'- CTTCTCCCAAACACTATAATTGAGTG -3'
Posted On2015-05-15