Incidental Mutation 'R4081:Tex10'
ID316870
Institutional Source Beutler Lab
Gene Symbol Tex10
Ensembl Gene ENSMUSG00000028345
Gene Nametestis expressed gene 10
Synonymsclone 18330, 2810462N03Rik, 2610206N19Rik
MMRRC Submission 040977-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4081 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location48430858-48473459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48468873 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 101 (S101G)
Ref Sequence ENSEMBL: ENSMUSP00000132498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]
Predicted Effect probably benign
Transcript: ENSMUST00000030030
AA Change: S101G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: S101G

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 130 235 9.7e-24 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155750
Predicted Effect probably benign
Transcript: ENSMUST00000155905
AA Change: S18G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345
AA Change: S18G

DomainStartEndE-ValueType
Pfam:Ipi1_N 47 152 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164866
AA Change: S101G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: S101G

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
Pfam:Ipi1_N 132 235 4.1e-25 PFAM
low complexity region 832 846 N/A INTRINSIC
low complexity region 856 873 N/A INTRINSIC
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G T 12: 55,304,613 V236F possibly damaging Het
Aass A T 6: 23,109,498 D324E possibly damaging Het
Adad1 A G 3: 37,064,363 probably null Het
Aim2 T C 1: 173,459,851 probably null Het
Arhgef1 G T 7: 24,925,846 D850Y probably damaging Het
Ccnf T C 17: 24,223,898 *778W probably null Het
Cd53 T C 3: 106,762,145 H179R probably benign Het
Cit G T 5: 115,948,050 R891L probably damaging Het
Clec4b1 T C 6: 123,069,774 probably null Het
Cntrl C A 2: 35,161,926 probably benign Het
Cntrl A G 2: 35,175,125 D2148G probably damaging Het
Cpa5 T C 6: 30,631,229 S381P probably benign Het
Crybg1 A T 10: 43,975,039 V1612D probably damaging Het
Cwc25 G T 11: 97,753,918 Q205K probably benign Het
Cyp2d11 A T 15: 82,391,801 I193N possibly damaging Het
Gdi2 T A 13: 3,548,866 C17S probably benign Het
Gm5436 T A 12: 84,258,715 noncoding transcript Het
Ifit1bl1 T C 19: 34,594,640 Y139C possibly damaging Het
Insr A T 8: 3,211,391 M321K probably benign Het
Ippk T A 13: 49,446,376 L237Q probably damaging Het
Itpr1 T A 6: 108,391,835 I149N probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lrp2 T A 2: 69,513,273 H914L probably damaging Het
Myd88 G T 9: 119,339,987 probably benign Het
Myh2 T C 11: 67,190,430 S1291P probably benign Het
Mylk3 G A 8: 85,328,682 L549F probably damaging Het
Otog T C 7: 46,288,299 S1811P possibly damaging Het
Phrf1 T C 7: 141,259,057 probably benign Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Ptprh T A 7: 4,580,988 T202S probably damaging Het
Ptprr A T 10: 116,236,710 K329N probably benign Het
Rgl3 T A 9: 21,987,675 H156L possibly damaging Het
Sema6b A G 17: 56,128,307 V312A probably damaging Het
Sez6l T C 5: 112,461,166 I606V probably benign Het
Slco1a1 T C 6: 141,935,962 E148G probably damaging Het
Snph T C 2: 151,593,802 D402G probably damaging Het
Sohlh1 A G 2: 25,845,722 V135A probably benign Het
Sox14 T C 9: 99,875,224 E154G possibly damaging Het
Spta1 A G 1: 174,214,066 D1334G probably benign Het
Stard13 C A 5: 151,092,829 probably null Het
Szt2 A G 4: 118,373,567 probably benign Het
Tab2 G A 10: 7,919,831 P296S probably damaging Het
Tbx15 A G 3: 99,313,054 D48G possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tulp4 C T 17: 6,231,780 H695Y probably damaging Het
Vmn1r66 A G 7: 10,274,806 I100T probably damaging Het
Vmn2r106 A T 17: 20,267,556 Y860* probably null Het
Vwa3b C T 1: 37,035,824 T24I probably damaging Het
Zfp541 G A 7: 16,072,135 S65N probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Tex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tex10 APN 4 48469937 nonsense probably null
IGL00832:Tex10 APN 4 48468864 missense probably benign
IGL01376:Tex10 APN 4 48456740 missense possibly damaging 0.90
IGL01594:Tex10 APN 4 48469906 missense possibly damaging 0.47
IGL02754:Tex10 APN 4 48435028 missense possibly damaging 0.46
IGL03071:Tex10 APN 4 48452946 missense probably benign 0.00
IGL03399:Tex10 APN 4 48459915 missense probably benign 0.04
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0105:Tex10 UTSW 4 48468957 missense probably damaging 0.99
R0544:Tex10 UTSW 4 48462766 splice site probably null
R0583:Tex10 UTSW 4 48451952 missense probably damaging 1.00
R0591:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0592:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0593:Tex10 UTSW 4 48456800 missense probably benign 0.04
R0893:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1485:Tex10 UTSW 4 48436492 missense possibly damaging 0.54
R1703:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1704:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1706:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1911:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1912:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1930:Tex10 UTSW 4 48456800 missense probably benign 0.04
R1983:Tex10 UTSW 4 48460059 missense possibly damaging 0.93
R2001:Tex10 UTSW 4 48451940 missense probably damaging 1.00
R2074:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2075:Tex10 UTSW 4 48456800 missense probably benign 0.04
R2157:Tex10 UTSW 4 48436522 splice site probably benign
R3000:Tex10 UTSW 4 48459393 splice site probably null
R4067:Tex10 UTSW 4 48459355 nonsense probably null
R4133:Tex10 UTSW 4 48468968 missense probably damaging 1.00
R4352:Tex10 UTSW 4 48452039 missense possibly damaging 0.77
R4364:Tex10 UTSW 4 48468774 missense probably benign 0.13
R4601:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4602:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4610:Tex10 UTSW 4 48452946 missense probably benign 0.00
R4707:Tex10 UTSW 4 48468984 missense probably benign 0.00
R4744:Tex10 UTSW 4 48469990 missense probably benign 0.00
R4778:Tex10 UTSW 4 48436468 missense probably damaging 1.00
R4989:Tex10 UTSW 4 48458525 splice site probably benign
R5051:Tex10 UTSW 4 48460019 missense possibly damaging 0.86
R5120:Tex10 UTSW 4 48459272 missense possibly damaging 0.68
R5732:Tex10 UTSW 4 48460046 missense probably damaging 1.00
R5799:Tex10 UTSW 4 48433295 missense possibly damaging 0.62
R5813:Tex10 UTSW 4 48452928 missense probably benign 0.00
R6091:Tex10 UTSW 4 48459891 missense probably damaging 0.98
R6223:Tex10 UTSW 4 48468525 missense probably damaging 0.98
R6493:Tex10 UTSW 4 48436450 missense probably damaging 1.00
X0017:Tex10 UTSW 4 48460080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCAGAACTTTTAAAGAGTCCTCCTG -3'
(R):5'- CTTGAACAAGGACTTCAGCTTATC -3'

Sequencing Primer
(F):5'- AAAGAGTCCTCCTGAATTCCTTC -3'
(R):5'- AAATGTTTGCTTGAATGTGATACG -3'
Posted On2015-05-15