Incidental Mutation 'R0391:Nod2'
ID31695
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission 038597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R0391 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88663778 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 238 (S238A)
Ref Sequence ENSEMBL: ENSMUSP00000050538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably benign
Transcript: ENSMUST00000054324
AA Change: S238A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: S238A

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109634
AA Change: S223A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: S223A

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118370
AA Change: S216A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: S216A

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124091
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.8%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,701,177 probably benign Het
Abcc2 G A 19: 43,821,605 probably benign Het
Abcc8 C G 7: 46,122,173 G838A probably damaging Het
Akr1c21 G A 13: 4,581,200 A245T probably damaging Het
Anapc15-ps T C 10: 95,673,277 E47G probably damaging Het
Apoa1 A G 9: 46,229,842 T79A probably benign Het
Atp6v1b1 A G 6: 83,756,921 H378R possibly damaging Het
C4b A G 17: 34,735,614 probably benign Het
Catsperd A T 17: 56,662,821 E638D probably benign Het
Cckar C T 5: 53,706,253 probably null Het
Cfap100 C T 6: 90,405,339 probably benign Het
Chd1 G T 17: 15,749,894 G970C probably damaging Het
Col14a1 A G 15: 55,446,259 probably benign Het
Col17a1 C T 19: 47,663,824 V698M probably damaging Het
Cpeb1 T C 7: 81,361,725 D156G possibly damaging Het
Cryl1 A G 14: 57,303,775 Y151H possibly damaging Het
Csmd3 C A 15: 47,657,573 V1881L probably damaging Het
Ctnnal1 C T 4: 56,847,921 A73T probably damaging Het
Cyp2c37 T C 19: 39,994,506 S180P probably damaging Het
Cyp2c54 T C 19: 40,072,169 T123A possibly damaging Het
Dennd6b T C 15: 89,187,214 D304G probably damaging Het
Dnmt3l T C 10: 78,051,916 probably benign Het
Eci1 G A 17: 24,433,260 probably null Het
Efhc1 A G 1: 20,960,188 Y115C probably damaging Het
Ern1 T A 11: 106,407,178 K706* probably null Het
Fam129c T A 8: 71,602,499 probably benign Het
Ghrl T C 6: 113,719,338 E31G probably damaging Het
Gpr108 A C 17: 57,243,101 V179G probably benign Het
Henmt1 A G 3: 108,958,535 probably benign Het
Ift172 A G 5: 31,286,667 V69A probably damaging Het
Il17ra T C 6: 120,476,979 probably benign Het
Il17rb T C 14: 30,004,347 N95D probably benign Het
Il17rb G T 14: 30,006,155 probably null Het
Iqub G A 6: 24,446,155 L757F probably benign Het
Itpr1 T C 6: 108,378,167 V473A probably benign Het
Itpr2 T G 6: 146,229,773 N1978H probably damaging Het
Klk1b26 T A 7: 44,012,727 F3Y probably damaging Het
Lars A G 18: 42,251,363 V50A probably benign Het
Lax1 G T 1: 133,680,066 H312Q probably benign Het
Lctl T C 9: 64,122,314 probably benign Het
Lrp2 T A 2: 69,456,858 D3745V probably damaging Het
Lrp2 G A 2: 69,460,337 probably benign Het
Lvrn A T 18: 46,850,466 H92L probably benign Het
March1 A G 8: 66,418,973 T385A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mbd5 T C 2: 49,272,416 V970A possibly damaging Het
Mccc1 A G 3: 35,963,570 probably benign Het
Mpp4 A T 1: 59,143,829 probably benign Het
Mrnip G A 11: 50,199,920 A304T probably damaging Het
Muc5b T C 7: 141,865,082 S3922P possibly damaging Het
Myh3 T A 11: 67,096,507 probably benign Het
Nbea A T 3: 56,037,277 H555Q probably damaging Het
Nlrp9c A T 7: 26,371,476 probably benign Het
Nmur1 A T 1: 86,387,678 V178E probably damaging Het
Ogfod1 A T 8: 94,063,023 T451S probably damaging Het
Olfr145 G A 9: 37,897,842 G146D probably benign Het
Olfr23 T C 11: 73,941,109 F288L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr716 T A 7: 107,148,187 Y290* probably null Het
Pcdh20 T C 14: 88,468,668 I399V probably benign Het
Pdlim1 G T 19: 40,243,573 H120Q probably damaging Het
Plg T C 17: 12,419,081 V798A probably damaging Het
Polr2c A G 8: 94,857,775 I39V possibly damaging Het
Ppfia2 C A 10: 106,830,714 probably benign Het
Ppp1r3a A T 6: 14,719,697 I406N probably benign Het
Psg28 A T 7: 18,426,173 M366K probably benign Het
Rad54b T C 4: 11,601,702 I419T probably damaging Het
Rnf43 A G 11: 87,731,282 Q403R possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc28a3 A G 13: 58,569,415 probably benign Het
Smad2 A T 18: 76,289,037 probably null Het
Smad4 G A 18: 73,658,649 P274S probably benign Het
Smchd1 A T 17: 71,403,154 V906D probably damaging Het
Soat2 C A 15: 102,158,753 R320S possibly damaging Het
Spata33 C T 8: 123,221,887 A57V probably damaging Het
Stab1 A G 14: 31,143,418 L1814P probably benign Het
Stab2 T C 10: 86,947,144 K680R probably benign Het
Stil A G 4: 115,041,172 probably null Het
Sympk T A 7: 19,046,849 L759H probably benign Het
Tet1 A T 10: 62,814,546 probably null Het
Tfpi2 A T 6: 3,965,460 N117K probably benign Het
Tle3 A G 9: 61,416,661 Y766C probably damaging Het
Trpt1 C A 19: 6,997,930 probably null Het
Tshz1 A G 18: 84,016,049 F78S possibly damaging Het
Ttc1 T C 11: 43,738,808 D177G probably damaging Het
Ttc13 T A 8: 124,674,401 Y741F probably damaging Het
Ulk3 C T 9: 57,594,832 S462L probably benign Het
Utrn C T 10: 12,525,333 probably benign Het
V1rd19 A C 7: 24,003,585 T159P probably damaging Het
Vars T C 17: 35,011,486 V515A possibly damaging Het
Vmn1r85 A G 7: 13,084,588 Y210H probably benign Het
Vmn2r89 A G 14: 51,455,978 T262A probably damaging Het
Vps53 G A 11: 76,121,579 T209I probably benign Het
Wdfy2 T C 14: 62,925,133 F95L possibly damaging Het
Wwp1 G T 4: 19,627,911 S694Y probably damaging Het
Zbtb8b T A 4: 129,432,670 D201V probably damaging Het
Zmym5 A C 14: 56,804,451 N123K possibly damaging Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1934:Nod2 UTSW 8 88663719 missense probably benign
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 intron probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCATTCCCCATGCAGGCTAC -3'
(R):5'- GAAGACATCGTCCTGAGCGACATC -3'

Sequencing Primer
(F):5'- AGCTGCTGAGTGTCAGAAGT -3'
(R):5'- TGCTCAAAGAGCAGCGTC -3'
Posted On2013-04-24